ID: 1002169011

View in Genome Browser
Species Human (GRCh38)
Location 5:177364974-177364996
Sequence CTCAAACTTCAGTGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002169011_1002169015 23 Left 1002169011 5:177364974-177364996 CCCACTCTGCACTGAAGTTTGAG 0: 1
1: 0
2: 2
3: 14
4: 164
Right 1002169015 5:177365020-177365042 CAGCATCTTGTGCCCTCCCACGG 0: 1
1: 0
2: 0
3: 16
4: 173
1002169011_1002169016 26 Left 1002169011 5:177364974-177364996 CCCACTCTGCACTGAAGTTTGAG 0: 1
1: 0
2: 2
3: 14
4: 164
Right 1002169016 5:177365023-177365045 CATCTTGTGCCCTCCCACGGTGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002169011 Original CRISPR CTCAAACTTCAGTGCAGAGT GGG (reversed) Intronic
901567556 1:10131173-10131195 CTCAAACTTAAAGGCAGAGAAGG + Intronic
901632165 1:10653293-10653315 CTCAGGCTGCAGAGCAGAGTCGG - Intronic
904864808 1:33570019-33570041 CTCACATTTCAGTGCAGCCTTGG - Intronic
906679861 1:47718976-47718998 CTCAAATTTCAGAGCCAAGTGGG - Intergenic
909549684 1:76883902-76883924 ATAAAATTTCAGTGCAGATTTGG + Intronic
912211168 1:107558659-107558681 GTCAAAATTCAGATCAGAGTGGG + Intergenic
916165762 1:161965836-161965858 CTCTTAGTTCAGTTCAGAGTAGG + Intergenic
916517172 1:165530196-165530218 CTCAAACTACAGTGCAGAGGTGG + Intergenic
917527713 1:175803684-175803706 CTCAAACATCAGTGCAGATGTGG - Intergenic
919179949 1:194067878-194067900 CACAAACTTCAGGGAACAGTAGG - Intergenic
919671072 1:200338628-200338650 TTCAAACTACAGTGCAGAGTTGG - Intergenic
923928804 1:238669096-238669118 CTCAAACTTCAGAAAAGAGGTGG - Intergenic
1062898385 10:1122453-1122475 GTCTGACTTCAGGGCAGAGTGGG - Intronic
1065258595 10:23900908-23900930 CTAAAGCTTCAGTGGAGATTAGG + Intronic
1066041341 10:31551080-31551102 CTCAAACCCCAGGGCAGAGATGG - Intergenic
1068020403 10:51575334-51575356 CTCAAACTGCAGTGTGGTGTTGG - Intronic
1071966825 10:90859856-90859878 TTCACCCTTCAGTGCAGAGGAGG + Intergenic
1072316557 10:94208932-94208954 CCCAAACTTCAGTCCAGGGGTGG + Intronic
1073164531 10:101433387-101433409 CTCAAACTTCAGGTTAGATTGGG - Intronic
1073864760 10:107789000-107789022 GTTAAAATTCAGTGCAGAGTAGG - Intergenic
1074431619 10:113399646-113399668 CTGCAACTCCAGTGCAGAGGAGG + Intergenic
1074781088 10:116802850-116802872 TTCAAACTTCTGTTCAGACTTGG - Intergenic
1075197054 10:120368915-120368937 CTCAAACTTGAGTGCATACAAGG - Intergenic
1075242621 10:120792615-120792637 CTCCAACATCAGAGGAGAGTGGG - Intergenic
1076561347 10:131367215-131367237 CTCATACTTCAGTGGAAAGAGGG - Intergenic
1078462740 11:11527186-11527208 CTCCATCCTTAGTGCAGAGTTGG - Intronic
1078645452 11:13137873-13137895 CTCTACCCTCAGTGCAGAGGTGG + Intergenic
1080489073 11:32743369-32743391 CTCAAACTTCAGTTGTGTGTAGG + Intronic
1080849685 11:36057330-36057352 CACAAACTTGAGTGTAGATTAGG - Intronic
1084095868 11:66910880-66910902 CTCAAACTGCAGTGCTGGGAGGG - Intronic
1085756988 11:79209879-79209901 ATCAAACTGCAATGCAGAGAAGG - Intronic
1091389286 12:116265-116287 CTCTAACTGTAGTGCAGACTTGG - Intronic
1091454613 12:597813-597835 CCACACCTTCAGTGCAGAGTTGG - Intronic
1091692392 12:2605927-2605949 CTCAACCTTCAGACCAGGGTAGG + Intronic
1092250902 12:6895855-6895877 CTCAAACTGGAGTGCAGTTTGGG - Intronic
1093168275 12:15830243-15830265 CTCAATCTTCAGTGTTGAGTTGG - Intronic
1093355586 12:18162822-18162844 CTGAAGCTTCACTGCAGTGTGGG - Intronic
1096795025 12:54071447-54071469 CTCCATCTTCATTCCAGAGTTGG + Intergenic
1099643597 12:85321869-85321891 TTCAAACTTCAGTTCACAGGTGG - Intergenic
1100258799 12:92911966-92911988 CCCAAATTTCAGTGCATACTTGG - Intronic
1103335120 12:120183672-120183694 CTCTTACTGCAGAGCAGAGTTGG + Exonic
1107407424 13:40127670-40127692 CTCAAACTTGAGTGCACATCAGG - Intergenic
1114636938 14:24192967-24192989 CTGAGACTTCAGTGGAGCGTCGG - Exonic
1114672792 14:24420907-24420929 CTCAAACTTCTGTTCAGACCTGG - Intergenic
1115447066 14:33502840-33502862 CTCAATCTGCAGTGCAGAGACGG - Intronic
1117460613 14:55941069-55941091 AGCAAACATCAGAGCAGAGTAGG - Intergenic
1119030930 14:71192287-71192309 CTTACACTTCAGTACATAGTTGG - Intergenic
1119545152 14:75466578-75466600 CACAAAGATCAGTGCAGTGTAGG - Intronic
1119808954 14:77500201-77500223 CTCAAGTTTCAGGGCAGGGTTGG + Intergenic
1119986988 14:79149250-79149272 GTCAAAGGTCAGTGCAGACTGGG - Intronic
1120015207 14:79465807-79465829 CTCAAAATTCAGAGCACATTTGG - Intronic
1122339974 14:101021598-101021620 CTCAAACCACAGAGCTGAGTGGG - Intergenic
1122575237 14:102737776-102737798 CTCAGCCTGCAGTGCTGAGTGGG - Intergenic
1123147208 14:106143394-106143416 CTCAAACTTCAGCTCAGTGCAGG - Intergenic
1123579541 15:21703949-21703971 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1123616168 15:22146460-22146482 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1126669517 15:51103345-51103367 CTCAAACATTATTGCAGAGAAGG + Intronic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1127516248 15:59696039-59696061 CTCACACTTCATGGCAGAGTGGG - Intergenic
1129821551 15:78605519-78605541 CTGAGGATTCAGTGCAGAGTGGG - Intronic
1131760662 15:95619127-95619149 CTCAACCATCAGTGCACACTGGG + Intergenic
1132263574 15:100446492-100446514 CTCAAAGATCACTGAAGAGTTGG - Intronic
1202988411 15_KI270727v1_random:438194-438216 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1133230892 16:4366013-4366035 CCCAAACCTTAGTGCAGATTCGG - Intronic
1133249181 16:4469139-4469161 CTCCAACCTCCCTGCAGAGTCGG + Intronic
1133649451 16:7797522-7797544 CCCAATCTTCAGTGAAGAGCAGG - Intergenic
1138862439 16:60774742-60774764 CTCGGACTGCAGTGCAGATTTGG + Intergenic
1141435808 16:83999134-83999156 CTCAAGCCTCAGTGCACAGGGGG - Intronic
1143199666 17:5103691-5103713 GGCTAACTTCAGTGCAGACTTGG + Intergenic
1143303666 17:5929339-5929361 CGCAAACTTTAGAGCAGAGCTGG - Intronic
1148587544 17:48791575-48791597 CTCCACCTTCAGTGCATACTTGG - Exonic
1148699983 17:49581462-49581484 CTCATACTGCAGCGCAGAGTTGG + Intronic
1150158855 17:62876722-62876744 CTCAACATTCAGGCCAGAGTTGG + Intergenic
1150992780 17:70280029-70280051 CTCACAATTCAGTGTAGAGGTGG + Intergenic
1152871996 17:82759616-82759638 CTAAAACTTCAGTAGAGACTGGG - Intronic
1153445131 18:5163245-5163267 CTCTAAATGCAGTGCAGATTTGG - Intronic
1160515438 18:79476916-79476938 CAGAAACTCCAGTGAAGAGTCGG + Intronic
1161230375 19:3172058-3172080 ATCAGTGTTCAGTGCAGAGTGGG + Intergenic
1164527400 19:29022267-29022289 GTCCAACTTCAGCGCACAGTGGG + Intergenic
1165733021 19:38158524-38158546 CTCAGTCTTCTGTGCAGAGGAGG + Intronic
1166224635 19:41387428-41387450 CTCAGAATCCAGGGCAGAGTTGG + Intronic
1167532092 19:50024348-50024370 GTCACACATCAGTTCAGAGTGGG + Intronic
925722234 2:6840617-6840639 CACAAACTTCACTGCCGAGCAGG + Intronic
927180513 2:20443425-20443447 CTCAAAGACCAGAGCAGAGTTGG - Intergenic
927462156 2:23308639-23308661 CACAAAAGTCAGTGCAGAATAGG - Intergenic
929305269 2:40354185-40354207 ATCATACTTCATTGCAAAGTTGG - Intronic
930460965 2:51675016-51675038 TTCAAAGTTCTGTGAAGAGTTGG - Intergenic
930514232 2:52385796-52385818 TTCAAACTTCAGTGTAGAAAGGG - Intergenic
931361596 2:61582648-61582670 CTCAAAATGAAGTGAAGAGTTGG - Intergenic
932658875 2:73634903-73634925 CTGAAGCTTCACTGCAGTGTAGG - Intergenic
932665470 2:73694866-73694888 CTGAAGCTTCACTGCAGTGTAGG - Intergenic
932876257 2:75455593-75455615 ATAAAACTTCAGTGCAGCCTGGG + Intergenic
934666911 2:96178262-96178284 CTCAAACTTTACTGCACATTAGG + Intergenic
937856994 2:126679575-126679597 CTCAAAAATTAGTGCAGAGTTGG + Intronic
939221803 2:139311319-139311341 CTCATGCTACACTGCAGAGTTGG - Intergenic
940235737 2:151509000-151509022 CTAAAACTTCCCTGAAGAGTGGG - Intronic
940446197 2:153780746-153780768 CTCAAATTTGAGTGGAAAGTAGG - Intergenic
940583350 2:155609950-155609972 CTCAGACTTCTGTGTAGATTGGG + Intergenic
941255967 2:163231284-163231306 CTCAAACTACAGTGCAGTTCTGG + Intergenic
942704495 2:178754941-178754963 TTCAAAATTCTGTGCAGAGATGG + Intronic
942967289 2:181911906-181911928 CTCAGACTTCAGAGCAGGTTTGG - Intronic
943928553 2:193819959-193819981 CTCCAATTTCAGAGCAAAGTTGG - Intergenic
944846708 2:203675996-203676018 CTAAAACTTCCGTGCAAAATTGG - Intergenic
1170035531 20:11985638-11985660 CTCAGACTTCAGTACAGGGAGGG - Intergenic
1173849621 20:46209861-46209883 CTCAAACTTAAGTTCAGAACTGG - Intronic
1174814269 20:53673373-53673395 AGAAAACTTGAGTGCAGAGTGGG - Intergenic
1180179028 21:46109731-46109753 CTCCAATCTCAGAGCAGAGTTGG - Intronic
1181342816 22:22196210-22196232 CTCAGTCTTCAGTCCAGAGATGG - Intergenic
1183927260 22:41215099-41215121 CTCAAACTTCGCTGCACATTAGG - Intronic
952556739 3:34540117-34540139 TCCAAACTTTAGTGCAGAGCTGG - Intergenic
956718042 3:72095547-72095569 CTCAAACTTGATTGCACACTGGG + Intergenic
957980239 3:87500107-87500129 CTCAAACAACATTGCAGAGCTGG + Intergenic
963975220 3:151472901-151472923 CTGAAGCTTCACTGCAGTGTGGG - Intergenic
970300449 4:14675949-14675971 CTGAAACCTCAGTGCTGAGAAGG - Intergenic
972797626 4:42437822-42437844 CTCAGAGTTTAGTGCAGACTTGG - Intronic
973916667 4:55640743-55640765 CTCCAGCTTCAGTGAAGAGCAGG + Intergenic
974619775 4:64340445-64340467 CTCCAATTTCAGAGCAAAGTTGG + Intronic
975271441 4:72438826-72438848 CTCAAAATGTAGTGCAGAGAGGG - Intronic
977311068 4:95387735-95387757 CTTAAACATCAGTTCAGTGTGGG + Intronic
977410079 4:96651685-96651707 CTCAACCTTCAGTGTACATTAGG + Intergenic
977883283 4:102230877-102230899 CTCAGCCTTCTGTGAAGAGTTGG - Intergenic
979417055 4:120454897-120454919 CTCAGAGTTCAGTTCAGAGTAGG - Intergenic
979664586 4:123296603-123296625 CAAAAAATTCAGTGCAGTGTTGG + Intronic
980842183 4:138277260-138277282 CTCAGACATCAGTGCAGGTTTGG + Intergenic
983174950 4:164577689-164577711 CTCACATTTCAGTGCAGCGTGGG - Intergenic
983802301 4:171947786-171947808 CTCAAACTCCAGTACATATTAGG - Intronic
983909204 4:173217765-173217787 ATCAAACTTCTGTGCAGACTTGG + Intronic
984342918 4:178481870-178481892 CTGAAAATTCAATGCAGAGTGGG + Intergenic
985301567 4:188495672-188495694 TTCAAACTTCAGTTCTAAGTAGG - Intergenic
986114153 5:4752960-4752982 CACAGCCTTCAGTGAAGAGTGGG + Intergenic
988763816 5:34347926-34347948 CTCACTCTTCAGTAAAGAGTTGG - Intergenic
997785547 5:136709504-136709526 CTCACACATCAGTGCAGGTTAGG - Intergenic
1000235756 5:159358798-159358820 CTCAAACTTATGTCCACAGTTGG + Intergenic
1001245414 5:170102447-170102469 CTCAAACCTCACTGCGGGGTGGG + Intergenic
1001423793 5:171609723-171609745 CTCAAACTACATTTCAGAGATGG - Intergenic
1001782728 5:174384369-174384391 CTCCATCTTCATTGCAGAGGTGG + Intergenic
1002169011 5:177364974-177364996 CTCAAACTTCAGTGCAGAGTGGG - Intronic
1002826456 6:778305-778327 CTCAAACTTCCATGCACATTAGG - Intergenic
1003920623 6:10829385-10829407 TTTAAAGTTGAGTGCAGAGTAGG - Intronic
1012603820 6:101132281-101132303 GTTAAACTTCAGGGCAGAGGTGG - Intergenic
1014287162 6:119513617-119513639 CTTAAATTTCACTGCACAGTAGG - Intergenic
1014671517 6:124310688-124310710 CTCTGACTTCAGTGGAGATTCGG - Intronic
1017517824 6:155173628-155173650 CCAAAACTTCAGTGCTGAGCTGG - Intronic
1017847603 6:158273033-158273055 CTCAAGCTCCAGTGAAGTGTCGG - Intronic
1018985434 6:168633071-168633093 CTCAAACAGCAGTGCAGATTGGG - Intronic
1019228620 6:170537448-170537470 CTAAAACTTCAGGGAACAGTTGG + Intronic
1020588358 7:10101871-10101893 CACAATGTTCAGTGCAGTGTTGG - Intergenic
1021438798 7:20653659-20653681 CTCAAATTTCAGGGCAGCTTGGG + Intronic
1025062362 7:55821341-55821363 CTGAAGCTTCAGGGCAGGGTGGG + Intronic
1027810362 7:82888967-82888989 CTGATACATCAGAGCAGAGTTGG - Intronic
1027968521 7:85045064-85045086 CAAAAACTTCACTGAAGAGTTGG + Intronic
1028160540 7:87479669-87479691 ATCAAACTTCTGTTTAGAGTGGG - Intronic
1028789234 7:94834726-94834748 CTCATTCTTCAGTGCTGAGAGGG + Intergenic
1033287659 7:140056571-140056593 CTCCCATTTCAGTGCAGACTAGG + Intronic
1035684779 8:1515216-1515238 CTGAAACTCAAGTGCAGGGTGGG - Intronic
1036133549 8:6138660-6138682 ATCAGACTGCAGTGCAGAGGTGG - Intergenic
1038198957 8:25393908-25393930 ATCAAACTTCAGTTCAGCTTTGG - Intronic
1039034325 8:33343329-33343351 CTCAAAGTTCTGTGCTGAGAAGG + Intergenic
1039725933 8:40216665-40216687 CAGAAACTTCAAAGCAGAGTGGG + Intergenic
1040138584 8:43884076-43884098 CTCAAACCCCAGTTCAGATTTGG - Intergenic
1040724880 8:50370489-50370511 CTCCATTTTCAGTGGAGAGTAGG + Intronic
1046273031 8:111920649-111920671 CTCACACTTGAATGCAGTGTAGG + Intergenic
1047335903 8:123936037-123936059 CTCAAACAGCTGTGCAGTGTTGG + Intronic
1048822167 8:138390582-138390604 CTGTATCTCCAGTGCAGAGTAGG + Intronic
1050634135 9:7592382-7592404 CTCAAACATAAGTTAAGAGTTGG - Intergenic
1051162262 9:14221826-14221848 CTCAAACTAAACTGCATAGTTGG + Intronic
1051328287 9:15997202-15997224 CTCAAACCACAGTGCAGATAAGG + Intronic
1051640339 9:19219018-19219040 CTCAGACTTCATTGCACATTAGG - Intergenic
1052910237 9:33874298-33874320 GTCAATTTTCAGTGCAAAGTAGG + Intronic
1055582785 9:77725400-77725422 CAAAAACATCACTGCAGAGTGGG + Intronic
1060003155 9:119976732-119976754 CTGAATCTTCAGTGTAGATTAGG - Intergenic
1060246294 9:121949278-121949300 CTCAAGCTTCAGGGCTGATTTGG + Intronic
1060387547 9:123245976-123245998 CTCAAACTCCATTGCCGAGTAGG - Intronic
1188809613 X:34636820-34636842 CTCCAACTGCAGTGCACAGTTGG + Intronic
1189741252 X:44119205-44119227 CTCAAACGAAACTGCAGAGTGGG + Intergenic
1193396522 X:80990370-80990392 CTCAAGCTCCAGTGCTGAGATGG - Intergenic
1194544761 X:95219314-95219336 CTCACACTTCAGTACAGCGGTGG - Intergenic
1197186071 X:123588801-123588823 CTAGAACTTCAGTACAGTGTTGG + Intergenic
1198160743 X:134005453-134005475 CTCAAATTTGGGTGCAGAGGTGG - Intergenic
1198532173 X:137558085-137558107 CACAAACTTCAGTCCACACTGGG - Intergenic
1200872983 Y:8123403-8123425 CTCAAACTCCAATTCAGATTTGG - Intergenic