ID: 1002170944

View in Genome Browser
Species Human (GRCh38)
Location 5:177373893-177373915
Sequence TGCAAAGATTCCAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002170944_1002170948 -2 Left 1002170944 5:177373893-177373915 CCTTCCCCATTGGAATCTTTGCA No data
Right 1002170948 5:177373914-177373936 CACTCGCTGTCTCCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002170944 Original CRISPR TGCAAAGATTCCAATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr