ID: 1002171223

View in Genome Browser
Species Human (GRCh38)
Location 5:177375640-177375662
Sequence TGCAGCATCTAGGCCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171223_1002171228 -8 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171228 5:177375655-177375677 ATGCTGCAGAAATCCCCGATGGG No data
1002171223_1002171230 0 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171223_1002171237 26 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171223_1002171227 -9 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171227 5:177375654-177375676 GATGCTGCAGAAATCCCCGATGG No data
1002171223_1002171234 12 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171223_1002171229 -7 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171229 5:177375656-177375678 TGCTGCAGAAATCCCCGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171223 Original CRISPR TGCAGCATCTAGGCCCCCTG GGG (reversed) Intergenic