ID: 1002171225

View in Genome Browser
Species Human (GRCh38)
Location 5:177375642-177375664
Sequence TCTGCAGCATCTAGGCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171225_1002171229 -9 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171229 5:177375656-177375678 TGCTGCAGAAATCCCCGATGGGG No data
1002171225_1002171234 10 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171225_1002171237 24 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171225_1002171228 -10 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171228 5:177375655-177375677 ATGCTGCAGAAATCCCCGATGGG No data
1002171225_1002171230 -2 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171225 Original CRISPR TCTGCAGCATCTAGGCCCCC TGG (reversed) Intergenic