ID: 1002171226

View in Genome Browser
Species Human (GRCh38)
Location 5:177375650-177375672
Sequence CGGGGATTTCTGCAGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171226_1002171230 -10 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171226_1002171234 2 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171226_1002171237 16 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171226 Original CRISPR CGGGGATTTCTGCAGCATCT AGG (reversed) Intergenic
No off target data available for this crispr