ID: 1002171230

View in Genome Browser
Species Human (GRCh38)
Location 5:177375663-177375685
Sequence GAAATCCCCGATGGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171218_1002171230 23 Left 1002171218 5:177375617-177375639 CCAGGCTGTCTGATGGGGACACA No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171224_1002171230 -1 Left 1002171224 5:177375641-177375663 CCCAGGGGGCCTAGATGCTGCAG No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171223_1002171230 0 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171217_1002171230 24 Left 1002171217 5:177375616-177375638 CCCAGGCTGTCTGATGGGGACAC No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171213_1002171230 30 Left 1002171213 5:177375610-177375632 CCAGCACCCAGGCTGTCTGATGG No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171225_1002171230 -2 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data
1002171226_1002171230 -10 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171230 5:177375663-177375685 GAAATCCCCGATGGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171230 Original CRISPR GAAATCCCCGATGGGGAGCC AGG Intergenic