ID: 1002171234

View in Genome Browser
Species Human (GRCh38)
Location 5:177375675-177375697
Sequence GGGGAGCCAGGTCCTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171224_1002171234 11 Left 1002171224 5:177375641-177375663 CCCAGGGGGCCTAGATGCTGCAG No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171225_1002171234 10 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171223_1002171234 12 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data
1002171226_1002171234 2 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171234 5:177375675-177375697 GGGGAGCCAGGTCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171234 Original CRISPR GGGGAGCCAGGTCCTCTCCC AGG Intergenic