ID: 1002171237

View in Genome Browser
Species Human (GRCh38)
Location 5:177375689-177375711
Sequence TCTCCCAGGAGAGCACTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002171226_1002171237 16 Left 1002171226 5:177375650-177375672 CCTAGATGCTGCAGAAATCCCCG No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171231_1002171237 -2 Left 1002171231 5:177375668-177375690 CCCCGATGGGGAGCCAGGTCCTC No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171233_1002171237 -4 Left 1002171233 5:177375670-177375692 CCGATGGGGAGCCAGGTCCTCTC No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171232_1002171237 -3 Left 1002171232 5:177375669-177375691 CCCGATGGGGAGCCAGGTCCTCT No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171223_1002171237 26 Left 1002171223 5:177375640-177375662 CCCCAGGGGGCCTAGATGCTGCA No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171225_1002171237 24 Left 1002171225 5:177375642-177375664 CCAGGGGGCCTAGATGCTGCAGA No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data
1002171224_1002171237 25 Left 1002171224 5:177375641-177375663 CCCAGGGGGCCTAGATGCTGCAG No data
Right 1002171237 5:177375689-177375711 TCTCCCAGGAGAGCACTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002171237 Original CRISPR TCTCCCAGGAGAGCACTTTG TGG Intergenic