ID: 1002173186

View in Genome Browser
Species Human (GRCh38)
Location 5:177386477-177386499
Sequence CAGGATCCCCACCACCAGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002173186_1002173188 -10 Left 1002173186 5:177386477-177386499 CCGGGCTGGTGGTGGGGATCCTG 0: 1
1: 0
2: 1
3: 36
4: 386
Right 1002173188 5:177386490-177386512 GGGGATCCTGGTGACCGTGCTGG 0: 1
1: 1
2: 1
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002173186 Original CRISPR CAGGATCCCCACCACCAGCC CGG (reversed) Exonic
900241906 1:1621239-1621261 CAGGAGCCCACCCACCACCCAGG - Intronic
900341171 1:2190009-2190031 CAGCTTCCCCACCCCCAGCTCGG - Intronic
900539863 1:3197256-3197278 CAGGGTCCCGACCCCCAGGCGGG + Intronic
900651109 1:3730513-3730535 CAGGGGCCCCAGCACAAGCCGGG + Intronic
901533374 1:9867323-9867345 CAGGGTCTCCAGCACCTGCCTGG + Intronic
901617880 1:10556226-10556248 CAGTATCACCAGCTCCAGCCAGG - Intronic
902071275 1:13740859-13740881 CAGCATCCTCACCATCAGCGGGG + Intronic
902568452 1:17331221-17331243 CGTGATCCACAGCACCAGCCTGG + Intronic
903174617 1:21573554-21573576 CAGGCTCCCCACAGCCAGCTTGG - Intronic
903179215 1:21597059-21597081 CATCGTCCCCACCCCCAGCCTGG - Exonic
904153826 1:28465677-28465699 CTGGATCCTCACCACCTGCAAGG - Exonic
904818241 1:33221275-33221297 CAGGATCCCCACCCACAGTCAGG - Intergenic
905440955 1:37996452-37996474 AAGGAACCCCACCGCCACCCTGG + Intergenic
905484238 1:38284386-38284408 CAGCTGCCCCAGCACCAGCCCGG + Intergenic
906319485 1:44807466-44807488 CAGGATCCCTCCCTCCAGTCTGG + Intergenic
908755408 1:67464982-67465004 CAAGAAGCCCTCCACCAGCCTGG + Intergenic
908898114 1:68923912-68923934 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
910619357 1:89236091-89236113 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
911242764 1:95483464-95483486 CAGCATCCCCAGCTCCAGCAGGG - Intergenic
911565975 1:99464037-99464059 AAGGGTCCCCACCACCAACCTGG + Intergenic
912370417 1:109169680-109169702 AAGTATTCCCAGCACCAGCCTGG - Intronic
912430249 1:109625077-109625099 CAGAATCCCCACCCCAAGCCTGG + Intronic
914397426 1:147283851-147283873 CATGATCCTCACCACAATCCTGG - Intronic
915549533 1:156624329-156624351 CAGGATCCCCGCCACCCCCTAGG + Exonic
915561931 1:156692707-156692729 CAGCACCCCCGCCCCCAGCCAGG - Intergenic
916487444 1:165272186-165272208 AAAGATCCCTCCCACCAGCCAGG + Intronic
916810447 1:168301023-168301045 GAGGATTCCCTCCACCATCCTGG - Intronic
917897296 1:179504332-179504354 CAGGATCCCCACCACATCCTGGG - Intronic
918346035 1:183608152-183608174 ACAGATGCCCACCACCAGCCTGG - Intergenic
918826494 1:189330981-189331003 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
919841264 1:201611031-201611053 CAGTATCCCCAGCGCCGGCCTGG - Intergenic
920512079 1:206558878-206558900 CAGGAGCCCCACCTACAGCCAGG - Intronic
921625769 1:217376300-217376322 CTGGATCCCATCCCCCAGCCAGG + Intergenic
923538002 1:234867835-234867857 CAGTGTCCCCACAACCAGCAAGG + Intergenic
924814521 1:247430169-247430191 CAGAAACCACACCACCGGCCGGG - Intronic
1063375627 10:5552693-5552715 CTGCATCTCCACCACCCGCCAGG + Intergenic
1063383526 10:5601733-5601755 CAGGAGTCCTAACACCAGCCAGG + Intergenic
1064803891 10:19109196-19109218 CAGCATCCCCACCCCCAGTGGGG - Intronic
1067344343 10:45427189-45427211 CAGTATCACCTTCACCAGCCTGG + Intronic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1069370921 10:67746935-67746957 CAGTTTCCCCAGCACCAGCAGGG - Intergenic
1069797411 10:71062212-71062234 CAGGACCCCCACGCCCAGCTGGG + Intergenic
1069866916 10:71509895-71509917 CAGGTACCCCACCTCCACCCTGG - Intronic
1069915610 10:71784886-71784908 CCGGATCCCCACCAGCATCTGGG - Intronic
1069995599 10:72340513-72340535 CAGAAACCCCACCCACAGCCAGG - Intronic
1070157731 10:73846405-73846427 CAGTAACCCCACCACCCACCAGG + Intronic
1070784986 10:79157679-79157701 CTGGATCCCCACCCCCAGCTTGG + Intronic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1072717784 10:97762996-97763018 CAGCAACCCCACCTCCGGCCTGG + Intergenic
1072890218 10:99316772-99316794 CAGCACCACCACCACCACCCAGG - Intergenic
1075084511 10:119405553-119405575 CTGGCTCCCCACCCCCACCCAGG + Intronic
1075285621 10:121183368-121183390 CAGGATCCCAGCCATCTGCCAGG - Intergenic
1075658273 10:124175809-124175831 CAGCCTCCCCTCCCCCAGCCTGG + Intergenic
1075716637 10:124559459-124559481 CAGGTTCCCCACCAGGGGCCTGG + Intronic
1075734300 10:124654633-124654655 CAGGGTCCCCACCCCCAGCTCGG + Intronic
1076580908 10:131510269-131510291 CAGGTGCCCCTCCCCCAGCCTGG + Intergenic
1076813197 10:132899636-132899658 CAGCATCTCTGCCACCAGCCGGG + Exonic
1076829039 10:132985145-132985167 GAGGGTTCCCAGCACCAGCCTGG - Intergenic
1077014179 11:392687-392709 CGGGATCCGGACCACGAGCCGGG + Intronic
1077093442 11:789646-789668 CACGTTCCCCACCCCCCGCCAGG + Intronic
1077233531 11:1469192-1469214 GAGGGTCCCCGCCACCAGCACGG + Intergenic
1077324579 11:1958264-1958286 CAGCCTCCCCTCCCCCAGCCCGG + Intronic
1078695643 11:13628805-13628827 CAGGTGCCCCTCCTCCAGCCTGG + Intergenic
1082253278 11:50005413-50005435 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
1083176104 11:60951420-60951442 CAGCATCTCCACCAGCAGCACGG + Exonic
1083262069 11:61528515-61528537 CAGGAACCCCAGCACGCGCCAGG - Intronic
1083412600 11:62504700-62504722 AAGGTTCCCCAGCCCCAGCCAGG - Intronic
1083900660 11:65641786-65641808 CTGGCTCCTCACCCCCAGCCAGG + Intronic
1084275682 11:68049897-68049919 GAGGTCCCCCACCACCCGCCAGG - Intronic
1084794420 11:71495722-71495744 CAGGGTCCCCAGCACCTGACGGG - Intronic
1085049706 11:73373998-73374020 CAGGATCCCCACCCCAGGCAGGG + Intergenic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1086494372 11:87386931-87386953 CAGAAGCCCCTCCCCCAGCCAGG - Intergenic
1087285555 11:96261277-96261299 CAGAATCCCCACCACCAAGAAGG + Intronic
1088320103 11:108546397-108546419 CAGCTTCCCCACTACCATCCTGG - Intronic
1089178545 11:116565264-116565286 AAGGCTCCCTACCATCAGCCTGG - Intergenic
1089663483 11:120001289-120001311 CAGCCTTCCCACCACCACCCGGG - Intergenic
1090064586 11:123491956-123491978 CAGGGTCCCCACCACCTACTTGG - Intergenic
1090734435 11:129598774-129598796 CAGGAACTCCAACTCCAGCCAGG + Intergenic
1091030617 11:132184273-132184295 CTGGATCCCCAGCCTCAGCCCGG - Intronic
1091154779 11:133362426-133362448 CAGGAGCCCATCCACCACCCAGG + Intronic
1202807558 11_KI270721v1_random:13441-13463 CAGCCTCCCCTCCCCCAGCCCGG + Intergenic
1091591197 12:1843837-1843859 CACCCTCCCCACCACCTGCCTGG + Intronic
1095428914 12:42111570-42111592 CAGGCGCCCCGCCTCCAGCCTGG - Intronic
1096231026 12:49897031-49897053 TAGGATGCCCAGTACCAGCCTGG + Exonic
1096694594 12:53340536-53340558 CAGCATCCCTACCCCCACCCAGG + Intronic
1097529513 12:60780859-60780881 AAGGAACCCCAACTCCAGCCAGG - Intergenic
1098977627 12:76919823-76919845 AGGGCTCACCACCACCAGCCCGG - Intergenic
1099502664 12:83432696-83432718 CAGGAACTCCAACTCCAGCCAGG - Intergenic
1099991136 12:89721628-89721650 CTGGTTCCCGACCACCTGCCGGG + Intergenic
1100846239 12:98661042-98661064 CAGGCTCCCCACCACACGCCGGG + Intronic
1101968761 12:109298138-109298160 CGCCATCCCCACCACCAGCAAGG + Intronic
1102454937 12:113065446-113065468 GGGCATCCCCACCCCCAGCCCGG - Intronic
1103723639 12:122987430-122987452 GAGCACCCCCACCACCTGCCAGG - Exonic
1104380218 12:128300826-128300848 TAGGAGCCTCAACACCAGCCTGG + Intronic
1104912413 12:132245639-132245661 CAGCACCCACACCCCCAGCCCGG + Intronic
1104990742 12:132622553-132622575 CATGGTCCCCACAGCCAGCCAGG + Intergenic
1105250735 13:18697231-18697253 CAGGTCCCCCACCACCACCGTGG - Intergenic
1105302675 13:19150298-19150320 CCGGTTTCCCACCACCAGCTGGG + Intergenic
1106945594 13:34824257-34824279 CAGCATCTCCACCACTAGACTGG - Intergenic
1107635917 13:42392466-42392488 CAGGATCACCACCTGAAGCCAGG - Intergenic
1107819538 13:44273709-44273731 CAGTATCCCCAACACCTGACTGG + Intergenic
1112092357 13:96094741-96094763 CTGGATTCAAACCACCAGCCCGG - Intronic
1113279358 13:108772068-108772090 CATGAGCCACCCCACCAGCCTGG - Intronic
1113549941 13:111184959-111184981 TGGGAGCTCCACCACCAGCCTGG - Intronic
1113892147 13:113742115-113742137 CAGGAGCCCCACTGCCACCCTGG + Intergenic
1114171846 14:20280472-20280494 CAGGCGCCCCTCCCCCAGCCTGG - Intronic
1115271841 14:31561484-31561506 CAGTGGCCCCGCCACCAGCCCGG - Exonic
1115467505 14:33731636-33731658 CAGCAACCACACCACCAGCTAGG + Intronic
1116570398 14:46508984-46509006 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1119088365 14:71757719-71757741 CAGGAACCCCCCCAGCATCCTGG - Intergenic
1119380964 14:74227888-74227910 CAGCATCCTCATCACCAGCCTGG + Intergenic
1121098693 14:91234940-91234962 CGGGAAGCCCACCACCAGCACGG + Exonic
1121142389 14:91554946-91554968 CAGTCTCCCCAGCACCAGCAGGG - Intergenic
1121333787 14:93064418-93064440 CAGGAAGGCCACCAGCAGCCAGG - Intronic
1121742809 14:96266071-96266093 CAGGATGCCCGCCACCATCAGGG + Intronic
1121789336 14:96687219-96687241 CAGGAAGCCCATCTCCAGCCTGG + Intergenic
1122415586 14:101548138-101548160 CAGCATCCCCACCCCCCACCCGG - Intergenic
1123150333 14:106175299-106175321 CAGGGTCTCCAGCACCTGCCTGG + Intergenic
1202834109 14_GL000009v2_random:65161-65183 CAGAATCCCCCCCACCCTCCCGG - Intergenic
1124637100 15:31372263-31372285 CAGCAGCCCCACCATCAGCCCGG + Exonic
1125004958 15:34806929-34806951 CATGCCCCCCACCACCACCCAGG + Intergenic
1125104800 15:35957921-35957943 CAGGATGCCCAGTAGCAGCCAGG - Intergenic
1125523461 15:40360803-40360825 CAGGCCCCCCACCTCCACCCAGG + Intronic
1125606839 15:40944290-40944312 CAGAATCTACACCACCACCCAGG + Intergenic
1125744714 15:41990427-41990449 CGGGCTGCCCACCACCAGACAGG + Intronic
1125882791 15:43208547-43208569 CAGGAGCCCCACCCCCTGCATGG - Intronic
1127898709 15:63325215-63325237 CAGGATCCCTACTGCCAACCTGG - Exonic
1128225066 15:65995789-65995811 CAGGGTGCCCACCAGCTGCCTGG + Intronic
1128709048 15:69858308-69858330 CAGGAGCTCCAGGACCAGCCTGG - Intergenic
1129110504 15:73334425-73334447 CAGAGCCCCCAGCACCAGCCGGG + Intronic
1129660073 15:77548502-77548524 CAGCGTCCCCACCTCCTGCCTGG - Intergenic
1130064248 15:80591663-80591685 CAGCACTCCCACCAGCAGCCCGG + Exonic
1130263266 15:82376205-82376227 CCAGTTCACCACCACCAGCCCGG - Intergenic
1130278037 15:82493461-82493483 CCAGTTCACCACCACCAGCCCGG + Intergenic
1130371155 15:83285683-83285705 AAGGATCCCCACCAGCAGCAAGG - Intergenic
1130470366 15:84220646-84220668 CCAGTTCACCACCACCAGCCCGG + Intergenic
1130477854 15:84335213-84335235 CCAGTTCACCACCACCAGCCCGG + Intergenic
1130493911 15:84452917-84452939 CCAGTTCACCACCACCAGCCCGG - Intergenic
1130592655 15:85225274-85225296 CCAGTTCACCACCACCAGCCCGG + Intergenic
1130927307 15:88395398-88395420 CACGCTCCCCACAACCAGCCCGG - Intergenic
1131483501 15:92801687-92801709 CAGGGTCCCCTTCAGCAGCCTGG - Intronic
1131942734 15:97585150-97585172 CAGGAACTCCAACTCCAGCCAGG - Intergenic
1132499822 16:280373-280395 CACGATCCCCGCCGCCCGCCCGG - Intronic
1132623644 16:879843-879865 CAGGATCCCCCCGGCCCGCCTGG + Intronic
1132663702 16:1072523-1072545 CAGGACCCCCACCCCAAGCTGGG + Intergenic
1132727895 16:1346657-1346679 CAGGTTCCCCTTCACCAGCGAGG - Exonic
1132851929 16:2028710-2028732 AAGGCTCCCCACCAGCTGCCGGG - Intronic
1132993849 16:2812455-2812477 CAGGAGCCCCACCAGCACCTTGG - Intergenic
1133013935 16:2930322-2930344 CAGGATCCCCACGCCCTCCCTGG + Intronic
1133174095 16:4000754-4000776 TCGGATCGCCATCACCAGCCTGG - Intronic
1134848370 16:17460407-17460429 CTGGGTCTCCACCACCAGCTAGG + Intronic
1135046449 16:19159723-19159745 GACGATGCCCACCACCAGCCAGG - Intronic
1136996675 16:35195510-35195532 CATTATCCCCACCTCCAGCTGGG - Intergenic
1137879372 16:52030896-52030918 CTGGAGCTCAACCACCAGCCTGG - Intronic
1138166460 16:54806313-54806335 CAGGATGCCAGCCACCAGCTTGG - Intergenic
1138733802 16:59227592-59227614 CAGTATCCCCTCTAGCAGCCTGG + Intergenic
1139418049 16:66830597-66830619 CGGGGTCCCCAGCGCCAGCCGGG - Intronic
1139612028 16:68066100-68066122 CTGGAGCCCCAGCACCTGCCTGG - Intronic
1139689093 16:68628171-68628193 CAGGATCCCCCCCACCCCACAGG - Intergenic
1139969800 16:70766694-70766716 CATGACCTCCACCTCCAGCCAGG - Intronic
1141419107 16:83900159-83900181 CAAGGTCACCACCACCACCCAGG + Intronic
1141423470 16:83931495-83931517 CAGGAGCCCCTCCTCCTGCCTGG - Intronic
1142204084 16:88774518-88774540 CAGAGTCCCCAGCAGCAGCCTGG + Intronic
1142596763 17:1033556-1033578 AAGGCCCCCCTCCACCAGCCAGG - Intronic
1144996180 17:19270766-19270788 CAGGAGCGACACCAGCAGCCTGG - Intronic
1145996918 17:29110197-29110219 CAGCGGCCCCAGCACCAGCCAGG + Intronic
1146461665 17:33050776-33050798 CAGTCTCCCCACCACCAAGCAGG - Intronic
1146706408 17:35003738-35003760 CACGCTCCCCACCGCCATCCAGG + Intronic
1148560199 17:48601786-48601808 CTGGAACCCCACCCCCACCCAGG + Intronic
1148773709 17:50081369-50081391 CAGCATCCCCACCATCAACATGG + Exonic
1148875579 17:50684926-50684948 CAGGTTTCCCAGCACCCGCCAGG - Intronic
1151231765 17:72690134-72690156 CTTGAGCCCCGCCACCAGCCTGG - Intronic
1151835149 17:76577889-76577911 CAGGGCCCCCATCACCTGCCCGG + Intronic
1152418031 17:80175700-80175722 CAGCGTCCCCACCACAAGCGGGG - Intronic
1152634877 17:81426846-81426868 CAGTTTCCTCACCAGCAGCCTGG + Exonic
1152650425 17:81490053-81490075 CAGCATCCCCACCAACACCCAGG - Intergenic
1154438113 18:14361695-14361717 CAGGTGCCCCACCACCACCGTGG + Intergenic
1155212996 18:23619186-23619208 CAGGAGGCGCAGCACCAGCCAGG + Intronic
1155268110 18:24113440-24113462 CATTATCCCCACAGCCAGCCAGG - Intronic
1155597970 18:27510434-27510456 CGGGAGCCCCTCCCCCAGCCTGG - Intergenic
1160812168 19:1017580-1017602 CAGGAGCACCTCCCCCAGCCTGG + Intronic
1161227055 19:3151580-3151602 CAGGGACCCCACCTCCACCCAGG + Intronic
1161376397 19:3941208-3941230 CAGGGTCCCCCCCGCCCGCCCGG - Intronic
1162430568 19:10625794-10625816 GAGCCTCCCCACCATCAGCCAGG + Intronic
1162550529 19:11355719-11355741 CGGGGTCCCCTCCCCCAGCCCGG - Intronic
1163644321 19:18479838-18479860 CAGGATACCTGCTACCAGCCTGG + Intronic
1163666757 19:18607050-18607072 CAGGCTTCCCACCCCCAGTCTGG + Intronic
1164134919 19:22405923-22405945 CAGGAACTCCAACTCCAGCCAGG + Intronic
1164699009 19:30269201-30269223 CAGGAACCCTGCCACCTGCCTGG + Intronic
1164775196 19:30847627-30847649 CTGGGTCCCCACCTCCACCCTGG - Intergenic
1165635103 19:37334002-37334024 TCGGATCCCCACCACCACCAGGG + Intronic
1166254844 19:41596127-41596149 CAGGACCCCCATCCCCATCCTGG + Intronic
1166318666 19:42003225-42003247 CGCGATCCCCACCACCCTCCAGG + Intronic
1166746895 19:45145858-45145880 CACCTTCCCTACCACCAGCCGGG + Exonic
1167004571 19:46767164-46767186 AGGGATCCCCACCGCCAGGCCGG + Intronic
1167307931 19:48719743-48719765 CAGGCTCCGCCCCACCAGCCTGG + Intergenic
1167451195 19:49570625-49570647 CAGGGTCCCCTCCACATGCCAGG + Intronic
1167557712 19:50206147-50206169 CAGCATCCTCACCTCTAGCCCGG + Intronic
1168152099 19:54454791-54454813 GAGCAGCCCCACCCCCAGCCTGG - Intronic
1202638572 1_KI270706v1_random:62531-62553 CAGAATCCCCCCCACCCTCCCGG + Intergenic
925751145 2:7091201-7091223 CAGGCTCCCGACACCCAGCCTGG - Intergenic
925904172 2:8529468-8529490 CAGCATCCTCACCAGAAGCCTGG + Intergenic
925945584 2:8859972-8859994 CAGGAGCCTCAAGACCAGCCTGG + Intronic
925992307 2:9263350-9263372 CAGGACCCCCCCAGCCAGCCTGG - Intronic
926712289 2:15891210-15891232 GAGGAGCCCCACCCCCATCCAGG + Intergenic
927283894 2:21336364-21336386 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
927518821 2:23687319-23687341 CTAGACTCCCACCACCAGCCTGG + Intronic
927920830 2:26970860-26970882 CCGGTTCCCCTCCCCCAGCCCGG - Intronic
928352325 2:30570785-30570807 CAGCATCACAACCACCTGCCTGG - Intronic
928765042 2:34635733-34635755 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
930227278 2:48806527-48806549 CAGGCTCTCCACCACCACCAAGG - Intergenic
930972929 2:57419132-57419154 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
932608827 2:73183455-73183477 CAGGTTAGCCATCACCAGCCTGG - Intergenic
933559748 2:83875237-83875259 CAGGATGCTCACCAGCACCCCGG - Intergenic
933579012 2:84104046-84104068 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
934506687 2:94899987-94900009 TAGGATCACCTCCGCCAGCCAGG + Intergenic
934658943 2:96132913-96132935 CCGGACCCCCATCACCAGCCTGG + Intronic
934941675 2:98507568-98507590 CGTGACCCCCACCCCCAGCCTGG + Intronic
936920968 2:117687855-117687877 CAAGATCCTTACCACCATCCAGG + Intergenic
937296668 2:120813648-120813670 CAGGTCCCCCACCACCACCCTGG + Intronic
937913797 2:127089173-127089195 CAGGATCCCAACCCCAGGCCTGG + Intronic
938288690 2:130138242-130138264 CCAGCTCCCCACCACCAGCTGGG + Intergenic
938467843 2:131534690-131534712 CCAGCTCCCCACCACCAGCTGGG - Intergenic
939074881 2:137588034-137588056 CAGGTGCCCCTCCCCCAGCCTGG + Intronic
939767409 2:146268030-146268052 CACACTCCCCACCAGCAGCCAGG - Intergenic
940055286 2:149506959-149506981 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
940615860 2:156047889-156047911 CAGGATTTCCAACTCCAGCCAGG + Intergenic
942511790 2:176710156-176710178 CAGGGCCAGCACCACCAGCCAGG - Intergenic
946787113 2:223259126-223259148 CAGACTCCCCTCCCCCAGCCAGG + Intergenic
946874156 2:224111258-224111280 GACATTCCCCACCACCAGCCTGG + Intergenic
947822977 2:233084858-233084880 AAGGAACCCCTCCACCAGCACGG - Intronic
947841684 2:233211825-233211847 CAAGATCCTCAGCACCAGTCTGG - Intronic
947922909 2:233893817-233893839 CAGGGTCCTCACTGCCAGCCAGG - Intergenic
948753628 2:240146277-240146299 CAGGCCCCCGACCACCAGCGTGG + Intergenic
948873762 2:240816984-240817006 TGGGATCCCCACCCTCAGCCTGG - Intronic
948981526 2:241497149-241497171 CAGGAGCCCCACCTGGAGCCTGG - Intronic
1169264409 20:4158843-4158865 GAGTATCACCACCACCCGCCAGG - Intronic
1170502562 20:16989679-16989701 CCTGATCCCCACCTCCAGCCTGG + Intergenic
1170827468 20:19808975-19808997 CATGAGGCCCCCCACCAGCCTGG - Intergenic
1171419624 20:25009117-25009139 CACCATCCTCACCACCAGCCAGG + Intronic
1171894285 20:30745380-30745402 TAGGATCACCTCCGCCAGCCAGG + Intergenic
1171896864 20:30815960-30815982 CAGCAGCCCCACCAGGAGCCTGG - Intergenic
1172303577 20:33866010-33866032 CAGTTTCCCCACCTCCAGCATGG + Intergenic
1172846236 20:37931364-37931386 CTGGAGCCACACCAGCAGCCGGG - Intronic
1176457564 21:6927774-6927796 CAGGTCCCCCACCACCATCCTGG - Intergenic
1176835736 21:13792858-13792880 CAGGTCCCCCACCACCATCCTGG - Intergenic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179233676 21:39527009-39527031 AAGGAAGCCGACCACCAGCCCGG - Intergenic
1179494577 21:41763777-41763799 CAGGCTCGCCCCGACCAGCCAGG + Intronic
1179994333 21:44967091-44967113 CAGGTCCCCCACCACCACCGTGG - Exonic
1180022506 21:45137400-45137422 CCCCATCCCCACCACCAGCATGG - Intronic
1180071884 21:45440750-45440772 CACGATCCCCACGTGCAGCCAGG - Intronic
1180085338 21:45505603-45505625 CAGGAGGACGACCACCAGCCGGG + Intronic
1180357649 22:11855997-11856019 CAGGATCACCTCCTCCAGCCAGG - Intergenic
1180363394 22:11919357-11919379 CAGAATCCCCCCCACCCTCCCGG - Intergenic
1180380616 22:12136336-12136358 CAGGATCACCTCCGCCAGCCAGG + Intergenic
1180856282 22:19047737-19047759 CAGACTCCTCACCACCAGGCGGG - Intronic
1180864281 22:19106952-19106974 CCAGAGCCCCACCACCAGTCTGG + Intronic
1181108257 22:20587256-20587278 CTGGCTCCCCGCCACCAGCTGGG + Exonic
1181638466 22:24185016-24185038 CACTCTCCCCACCCCCAGCCTGG - Intronic
1182704710 22:32269910-32269932 CAGCGTCCTCACCACCAGCATGG + Intergenic
950519074 3:13485494-13485516 TAGGCCCCCCACCCCCAGCCTGG - Intronic
950566150 3:13770820-13770842 GAGGATGCCCACCACGTGCCTGG + Intergenic
950854894 3:16095700-16095722 TAAGATCCCCACCACCATCCAGG - Intergenic
951232752 3:20198912-20198934 CAGGATCCCCATCACCAACTAGG - Intergenic
951232828 3:20199559-20199581 CAGGATCCCCATCACCAACTAGG + Intergenic
952612325 3:35226241-35226263 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
952936909 3:38405820-38405842 CAGGCGCCCCTCCCCCAGCCTGG - Intronic
953407425 3:42666359-42666381 CAGGACCCCCACCCCAAGGCTGG + Intergenic
953878949 3:46681759-46681781 CAGGACCCCTCCCTCCAGCCTGG + Intronic
954110032 3:48428806-48428828 GAGGGTCCCCCCCACCCGCCCGG + Intronic
954230750 3:49215257-49215279 CAGGAGTCCCAAGACCAGCCTGG - Intronic
954402062 3:50324074-50324096 CAGGATCACCATATCCAGCCTGG - Intronic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954529264 3:51304236-51304258 CAGTTTCCCCAGCACCAGCAGGG + Intronic
954684923 3:52365209-52365231 CTGCCTCCCCACCACCAGGCGGG - Intronic
956272090 3:67458723-67458745 CAGGAACCACCCCACCAGTCAGG + Intronic
958877977 3:99637781-99637803 CAGGAACCTCAGAACCAGCCTGG - Intergenic
960970420 3:123135352-123135374 CAGGATCCCCAGAACCTGCATGG - Intronic
962292641 3:134149346-134149368 CATGAACCACACCACCAGCCTGG + Intronic
962585894 3:136842504-136842526 CAGGAACCCCTCCCCCAGTCTGG - Intronic
962622120 3:137190458-137190480 TAGGACCCTCACCACCAGCCTGG - Intergenic
963064555 3:141253069-141253091 CAGGATCCACACCACCAGGCAGG - Intronic
963077219 3:141358285-141358307 CAGGATCCCTCCCACCATCTTGG - Intronic
963122443 3:141787710-141787732 CAGAATACCTACCACCAGTCAGG + Intronic
968276834 3:197446617-197446639 CAGGATCAGCAGCACCAGCATGG + Intergenic
968656295 4:1779801-1779823 CAAGGGCCCCACCTCCAGCCTGG + Intergenic
969166833 4:5323291-5323313 CAAGTCCCCCTCCACCAGCCAGG + Intronic
973566912 4:52198032-52198054 CATCATCCCCACCACCAACGTGG - Intergenic
975730789 4:77335324-77335346 CCAGTTCACCACCACCAGCCTGG - Intronic
979074777 4:116257606-116257628 CGGGCGCCCCTCCACCAGCCTGG + Intergenic
979729601 4:124008533-124008555 CCAGATCCCCACCCCCAGACAGG + Intergenic
980104495 4:128574875-128574897 CTGGCTCCCCACCACCACCCTGG + Intergenic
981380847 4:144069927-144069949 CAGAATCCCCACCAGCAACAAGG - Intergenic
982517217 4:156367692-156367714 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
984540987 4:181036481-181036503 GATGAGCCCCACCACCACCCAGG - Intergenic
1202765911 4_GL000008v2_random:148390-148412 CAGAATCCCCCCCACCCTCCCGG + Intergenic
985678350 5:1243706-1243728 CAGGACCCCCACGTCCAGCAGGG - Exonic
988646564 5:33101600-33101622 CAGGTGCCCCTCCCCCAGCCTGG + Intergenic
989365757 5:40653396-40653418 CACATTCCCCAGCACCAGCCTGG + Intergenic
990703087 5:58496819-58496841 CAGAAGCACCAGCACCAGCCAGG + Exonic
990714745 5:58624269-58624291 GAGGATGCCCAACACCATCCTGG + Intronic
994052540 5:95379279-95379301 ATGGCTGCCCACCACCAGCCTGG + Intergenic
995264169 5:110138905-110138927 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
996004645 5:118405626-118405648 CAGCTTCCCCAGCACCAGCAGGG + Intergenic
996729252 5:126701474-126701496 CACCACCACCACCACCAGCCTGG - Intergenic
997847507 5:137301238-137301260 CAGGATCTTCTCCTCCAGCCTGG + Intronic
998059024 5:139104603-139104625 CAGCATCACCAGCACTAGCCTGG + Intronic
998503797 5:142655833-142655855 CGGGCTCCCCTGCACCAGCCTGG - Intronic
999126192 5:149247865-149247887 CCGGAGCTCCACCAGCAGCCGGG + Exonic
999434753 5:151554608-151554630 CAAGATGCCTACCACCACCCTGG + Exonic
1000404592 5:160873946-160873968 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1000553621 5:162696466-162696488 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1001409206 5:171498325-171498347 CAGGGTGCCCAACGCCAGCCTGG + Intergenic
1002173186 5:177386477-177386499 CAGGATCCCCACCACCAGCCCGG - Exonic
1002527779 5:179824421-179824443 CAGGATACCCCCCACCTTCCTGG + Intronic
1002809441 6:613038-613060 CAGGAACCTCACCACCACCCAGG + Intronic
1002967576 6:1982094-1982116 CAGGAGTCCCAAGACCAGCCTGG + Intronic
1002991895 6:2245818-2245840 CAGGCCCCCCACGGCCAGCCAGG - Intergenic
1003246657 6:4387709-4387731 CCAGTTCACCACCACCAGCCTGG + Intergenic
1003387267 6:5680342-5680364 AAGCATCCACACCACCAGCTTGG + Intronic
1005747144 6:28848854-28848876 GAGGACCCCCTCCCCCAGCCAGG - Intergenic
1006200877 6:32289244-32289266 CATGAGCCCCACACCCAGCCAGG + Intronic
1006434334 6:34018467-34018489 CAGGACCCCCACCCCCATTCTGG - Intergenic
1006439622 6:34045741-34045763 CAGGAACCCCAGGACCAGGCAGG + Intronic
1006520831 6:34570209-34570231 CAGGATCCCCGCGCCCAGTCTGG + Intergenic
1006547499 6:34792063-34792085 CACGATCCCACCCACCAGCGCGG - Exonic
1010679612 6:78783554-78783576 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1013390247 6:109679260-109679282 CAGACTCCCCTCCCCCAGCCAGG - Intronic
1016875855 6:148864204-148864226 CAGGCGCCCCTCCCCCAGCCTGG + Intronic
1018174457 6:161166904-161166926 CAGGAGCCCCAGCACCTGCAGGG + Intronic
1018944661 6:168339056-168339078 CAGGATTCCCAGCCCCAGACAGG + Intergenic
1019106404 6:169671116-169671138 CAGGACACCCACAAGCAGCCAGG + Intronic
1019137791 6:169922146-169922168 CAGTCTCCCCACCAGCAGCCTGG - Intergenic
1019377217 7:699196-699218 TGGGTTCCCCACCATCAGCCAGG - Intronic
1019510236 7:1414088-1414110 CAGGAGCCCCCGGACCAGCCGGG + Intergenic
1019585854 7:1803013-1803035 CACCATCTCCACCCCCAGCCAGG - Intergenic
1019769610 7:2875521-2875543 CAGGATCACCTCCACCTCCCAGG + Intergenic
1020055994 7:5117801-5117823 CAGGATGACCACCAGCACCCGGG - Intergenic
1021186962 7:17575912-17575934 CAGTCTCCCCAACACCAGCAGGG - Intergenic
1021772476 7:24019417-24019439 CTTGCTCCCCACCACCAACCTGG + Intergenic
1022088929 7:27095470-27095492 CAGCATCACCACCACCACCAGGG - Exonic
1022131149 7:27405676-27405698 CAAGATCACCAATACCAGCCAGG - Intergenic
1023600457 7:41877086-41877108 CAGAATCTCCACCACAGGCCTGG - Intergenic
1023688897 7:42765428-42765450 CAGGGACCCCACCGCCTGCCTGG + Intergenic
1023729152 7:43173805-43173827 CAGTATCACCTCCACCACCCAGG + Intronic
1024558961 7:50627859-50627881 CAGGCTCCACACAGCCAGCCTGG - Intronic
1025731167 7:64109480-64109502 TAGGATCACCTCCACCAGCTGGG + Intronic
1027374872 7:77538437-77538459 CAAGTTCCCCACCCCCACCCCGG - Intronic
1029187807 7:98752155-98752177 CAGGATCCTCCCCACCACGCTGG - Intergenic
1029431920 7:100536844-100536866 CAGGCTGCCAGCCACCAGCCTGG + Intergenic
1030035220 7:105403190-105403212 CAGGAGCTCCAAGACCAGCCTGG - Intergenic
1030084924 7:105807768-105807790 CAGCCTCCCAACCACCAGACAGG + Intronic
1030603280 7:111612723-111612745 CAGTCTCCCCACTACCACCCAGG - Intergenic
1030788616 7:113695046-113695068 CAGGCTCCCCACCTGCTGCCAGG - Intergenic
1032096248 7:128939658-128939680 CAGTGCCCCCACCACCACCCAGG - Intronic
1032130706 7:129225205-129225227 CAGGGTCTCCACCGCCCGCCGGG - Exonic
1033583912 7:142760378-142760400 CAGGTCCTCCACCACCAGTCAGG + Intronic
1035072652 7:156156747-156156769 CAGGGTGGCCACAACCAGCCTGG - Intergenic
1035606785 8:934615-934637 CACCGTCCCCACCACAAGCCGGG - Intergenic
1036578184 8:10048114-10048136 CAGGATCACAACCCCCAGACTGG - Intergenic
1037822248 8:22140679-22140701 CAGCATCCCAAACACCAGCCTGG + Exonic
1039466349 8:37788045-37788067 CAGGCTCCCCGCCACAGGCCCGG + Intronic
1040608538 8:48959585-48959607 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1040841804 8:51792638-51792660 CAGTCTCCCCAGCACCAGCAGGG - Intronic
1040951265 8:52940656-52940678 CAGGATTGCCACCACCAGGAAGG - Exonic
1040981484 8:53250671-53250693 CAGAGTCCCCACCACCTGGCTGG + Intronic
1040983539 8:53269460-53269482 CCGGTTTACCACCACCAGCCTGG - Intergenic
1041021374 8:53642402-53642424 CAGGAGCTCCAACTCCAGCCAGG - Intergenic
1041078626 8:54191982-54192004 CAGGGCCCCTCCCACCAGCCAGG - Intergenic
1042833435 8:73055919-73055941 CAGGCGCCCCTCCCCCAGCCAGG - Intergenic
1045952249 8:107865332-107865354 GACAATCCCCAACACCAGCCTGG - Intergenic
1048093145 8:131262521-131262543 CAGGCACCCCTCCCCCAGCCTGG - Intergenic
1048503756 8:135002233-135002255 GAGGATCCCCAAGACCAGCAAGG - Intergenic
1049645171 8:143732938-143732960 CAGGAACCCCACTTCCTGCCAGG - Intronic
1049646785 8:143739173-143739195 CTGCACCCCCACCTCCAGCCTGG - Intergenic
1049677837 8:143900667-143900689 CAGGAGCCCCAGCCCCACCCTGG - Intergenic
1050386591 9:5097317-5097339 TAGGATCACCCCCACCAGCAGGG - Intronic
1052457150 9:28714332-28714354 CAGGATCCCAATCACCATCAAGG + Intergenic
1054354368 9:64047394-64047416 TAGGATCACCTCCACCAGCCAGG - Intergenic
1055945689 9:81689380-81689402 CGGGACCCGCGCCACCAGCCCGG - Intergenic
1056364657 9:85892209-85892231 CAGGATCAACACCACAATCCTGG + Intergenic
1057388721 9:94625836-94625858 CAGGACCCTCACCACCTGCAAGG + Intronic
1057443440 9:95097984-95098006 CAGGACCACCTCCCCCAGCCCGG - Intergenic
1058012008 9:99988971-99988993 CAGGCACCCCTCCTCCAGCCAGG - Intronic
1058302959 9:103398899-103398921 CAGGAGCTCAAGCACCAGCCTGG + Intergenic
1059445830 9:114337228-114337250 CAGCCTCTCCCCCACCAGCCCGG - Exonic
1059945504 9:119404882-119404904 CAGGATCCCCACCCCAATCCAGG + Intergenic
1059965064 9:119605740-119605762 CAGTGTCCCCACCACCAAGCTGG - Intergenic
1060797620 9:126523173-126523195 CAAGTTCCCTCCCACCAGCCAGG + Intergenic
1061038636 9:128127405-128127427 CAGCATCCCCATCCCCGGCCGGG + Intronic
1061091521 9:128429042-128429064 CAGGGCCCCCCCCACCAGGCAGG - Intronic
1061807536 9:133144669-133144691 CAGGAACCCAGCCCCCAGCCAGG - Intronic
1061861555 9:133471041-133471063 CAGGAGCCCCCACAGCAGCCAGG - Intergenic
1061940297 9:133880323-133880345 CAGGTCCCTCACCACCTGCCTGG - Intronic
1062026389 9:134342617-134342639 CCGCAGCCCCACCACCTGCCTGG - Intronic
1062118373 9:134821201-134821223 CAGGGTCCCCACGGCCAGCGGGG + Intronic
1062156045 9:135049175-135049197 CAGGGTCCCTCCCACCAGGCAGG - Intergenic
1062290751 9:135793351-135793373 TGGGACCCCCACCACCAGGCAGG - Intergenic
1203742703 Un_GL000218v1:16517-16539 TAGGATCACCTCCGCCAGCCAGG - Intergenic
1203702901 Un_KI270742v1:11098-11120 TAGGATCACCTCCGCCAGCCAGG - Intergenic
1203546662 Un_KI270743v1:133279-133301 CAGAATCCCCCCCACCCTCCCGG + Intergenic
1185734961 X:2489456-2489478 CAGGTACCCCACCATCAGCATGG - Exonic
1186610595 X:11134744-11134766 CCTGCTCCCCACCAGCAGCCTGG - Intergenic
1187105378 X:16236408-16236430 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1189298426 X:39935424-39935446 CAGGAGGCCCACCAGCAGGCAGG - Intergenic
1189940161 X:46112976-46112998 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
1189993647 X:46618218-46618240 TAGGATCCCCACCTAAAGCCTGG - Intronic
1190942145 X:55052509-55052531 CAGGCACCCCTCCCCCAGCCTGG + Intergenic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1191830040 X:65406828-65406850 CGGGACCCGCGCCACCAGCCCGG + Intronic
1193595435 X:83439385-83439407 CTGTCTCCCCACCACCAGCAGGG + Intergenic
1194014396 X:88601043-88601065 TAAGAACACCACCACCAGCCAGG - Intergenic
1197438384 X:126460369-126460391 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1197497812 X:127207565-127207587 CAAGATCCCCTCCCCCACCCAGG - Intergenic
1197624122 X:128783079-128783101 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1198639574 X:138741921-138741943 CAGGTTCCACACTACCAGACTGG + Intronic
1200108001 X:153725091-153725113 CAGGGGCCCCAGCACCACCCCGG + Exonic
1201156237 Y:11133989-11134011 TAGGATCACCTCCGCCAGCCAGG - Intergenic
1202014503 Y:20386262-20386284 CAGGCACCCCTCCCCCAGCCTGG + Intergenic
1202343904 Y:23900870-23900892 CAGGACTCCCACCTCCAGCCTGG - Intergenic
1202526864 Y:25769214-25769236 CAGGACTCCCACCTCCAGCCTGG + Intergenic