ID: 1002174142

View in Genome Browser
Species Human (GRCh38)
Location 5:177391873-177391895
Sequence GCTTCTTATACCAACCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002174142_1002174144 16 Left 1002174142 5:177391873-177391895 CCAGGGTGGTTGGTATAAGAAGC 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1002174144 5:177391912-177391934 TCTGCCTAACAGCAAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002174142 Original CRISPR GCTTCTTATACCAACCACCC TGG (reversed) Intronic
900823754 1:4910129-4910151 AATTCTGATGCCAACCACCCAGG + Intergenic
902150232 1:14436997-14437019 GCTTCTTTTACCAACTACCCTGG + Intergenic
902664683 1:17929274-17929296 GCTGCTTATGCCTACCACGCAGG + Intergenic
905367951 1:37465503-37465525 GCTTCTTATCCCAGCTACACAGG + Intergenic
907018884 1:51045675-51045697 GCCTGTAATCCCAACCACCCAGG - Intergenic
915108522 1:153548821-153548843 TCTTCTTATCCCCAACACCCAGG + Intronic
915663923 1:157427483-157427505 ACTTGCTATAACAACCACCCTGG - Intergenic
917766160 1:178219693-178219715 GCCTCTTACACCAAACAGCCAGG - Intronic
921226171 1:213021895-213021917 GCTTGTAATCCCAGCCACCCGGG + Intergenic
924235389 1:241995792-241995814 GCTTGTAATACCAGCCACTCGGG + Exonic
1063320131 10:5044848-5044870 GAATCTTATCCCAAGCACCCAGG + Intronic
1063677082 10:8150310-8150332 GCTTCTTTTCCCAACCACATTGG - Intergenic
1066954276 10:42150034-42150056 GCTTCTTACACCCGCCACCGCGG - Intergenic
1067356452 10:45532688-45532710 GCTTGTTATTTAAACCACCCAGG + Intronic
1067976578 10:51032632-51032654 GCTTCTAATCCCAACTACTCAGG + Intronic
1069945649 10:71983573-71983595 GCTTATAATCCCAGCCACCCAGG - Intronic
1069979022 10:72239280-72239302 GCCTGTAATCCCAACCACCCAGG + Intergenic
1072545514 10:96433898-96433920 GCCTGTTATACCAACTACTCGGG - Intronic
1075463375 10:122633209-122633231 GCTTCCTATCCCAACCATCAGGG + Exonic
1078245669 11:9572180-9572202 GCTTGTAATACCAGCTACCCGGG + Intergenic
1078792734 11:14560578-14560600 GCTTCTTATCCCTGCAACCCTGG - Intronic
1079098024 11:17523347-17523369 ACTTCTCATCCCCACCACCCTGG - Intronic
1080843046 11:36002566-36002588 GCTTATCTTACCAGCCACCCAGG + Intronic
1083221637 11:61256729-61256751 GCCTCTAATCCCACCCACCCGGG + Intergenic
1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG + Intronic
1083724046 11:64619169-64619191 CCTTCTGGTACCAACAACCCAGG + Intronic
1091704513 12:2684740-2684762 TCTTCTTATGCAAATCACCCTGG - Intronic
1091711085 12:2741077-2741099 TCTTCTTATGCAAATCACCCCGG - Intergenic
1099385881 12:82012563-82012585 GCTGCTTATAACAACCAAACAGG - Intergenic
1108203314 13:48063095-48063117 GCTTCTAATCCCAGCCACCTGGG + Intronic
1109402968 13:61858760-61858782 TCTTCTTTTCCCAAGCACCCAGG + Intergenic
1112423521 13:99275635-99275657 GCCTCTTCTACCCACCCCCCAGG + Intronic
1112974240 13:105297670-105297692 TCTTCTTTTTTCAACCACCCAGG - Intergenic
1113958104 13:114110091-114110113 TTTTCTTTTACCAACCACCCAGG - Intronic
1114481047 14:23034692-23034714 GCTTCATGGAACAACCACCCTGG - Exonic
1118845519 14:69545121-69545143 GCTGCTTATGCCACCCAGCCTGG - Intergenic
1119394355 14:74315336-74315358 GCTTGTTATACCAACTACTCAGG - Intronic
1122318361 14:100838774-100838796 GTTTCCTTTCCCAACCACCCAGG - Intergenic
1122670774 14:103370422-103370444 GCTTCTTATCCCAGCTACTCGGG - Intergenic
1123923856 15:25089731-25089753 GCTTTTTATACCAACACCACCGG - Intergenic
1128265951 15:66266645-66266667 GCCTGTAATACCAACCACTCGGG + Intergenic
1134272964 16:12750246-12750268 GCTTCTTGTGCCAAACAGCCAGG - Intronic
1135277820 16:21128568-21128590 GCCTGTAATCCCAACCACCCGGG + Intronic
1138724450 16:59120417-59120439 GCTTTTTATTCCAGCCACTCTGG + Intergenic
1150387691 17:64774250-64774272 CCTTCTTATACAAGCAACCCTGG - Intergenic
1151248721 17:72816982-72817004 GCATCTAATATCAAGCACCCTGG - Intronic
1161860773 19:6796573-6796595 GCTTCTTGTACTAACCTCACTGG + Intronic
1165586706 19:36923095-36923117 GCTTCCTATTCCATCCATCCTGG + Intronic
1167496788 19:49824156-49824178 GCATTTAATACTAACCACCCTGG + Intronic
1168629536 19:57946435-57946457 GCTGCTAATACCAAAAACCCTGG + Intronic
925884687 2:8384485-8384507 GTTTCTTATTCCAAAAACCCAGG - Intergenic
926696030 2:15770735-15770757 GCTTCTTGGACCAGTCACCCTGG + Intergenic
926898853 2:17727279-17727301 GCTTTATATTCCAACCACACTGG - Intronic
929654842 2:43720419-43720441 GCTTTTTAACCCAGCCACCCCGG + Intronic
930032596 2:47067719-47067741 GCTTGCTATACCAAGCACCTAGG + Intronic
930378701 2:50599763-50599785 GCTTCTTATAGGAAACATCCAGG - Intronic
930989063 2:57628616-57628638 GCTTCTTATGGCAGCCACCTGGG - Intergenic
932139236 2:69260950-69260972 GCTTCTCTTACCATCAACCCTGG - Intergenic
934331576 2:92074045-92074067 GCTTTTTATCCCCACCACCGAGG + Intergenic
935290076 2:101602795-101602817 CTTTCTTATACCAACCTCACAGG + Intergenic
942441491 2:176041960-176041982 GCTTCTCATACCAAGAATCCAGG + Intergenic
947035903 2:225854465-225854487 GCCTGTAATACCAACCACTCTGG + Intergenic
1171457249 20:25278983-25279005 GCTTCGTATGCCAACAACCGTGG + Intronic
1172816167 20:37688486-37688508 GCTTCTTATTCCCAACATCCAGG - Intergenic
1174773506 20:53322963-53322985 CCTTCTTCTACAACCCACCCTGG - Intronic
1180113347 21:45677148-45677170 GCCTCTTATGCCAAACAACCAGG + Intronic
1182248261 22:28978260-28978282 GCTTCTCAGAACAATCACCCTGG + Intronic
1184326014 22:43786236-43786258 GCTTGTTATCCCAGCTACCCGGG + Intronic
949895302 3:8763817-8763839 GGTTCTTATAACAACTAACCAGG + Intronic
951599068 3:24352590-24352612 CCTTTTAAAACCAACCACCCCGG - Intronic
969503849 4:7571342-7571364 CCTTGTCATACCCACCACCCAGG - Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
978554094 4:109959874-109959896 GATTCTTAGACAAACCAGCCTGG - Intronic
979354662 4:119688996-119689018 GTTTCTTATAACAACCAACAAGG + Intergenic
979932585 4:126650114-126650136 GCTTTTCATTACAACCACCCAGG + Intergenic
984209215 4:176825140-176825162 CCCTCTTACACCAACCACCTGGG + Intergenic
986244292 5:5991270-5991292 GCTCATCATACCAAGCACCCAGG - Intergenic
991654589 5:68891589-68891611 GCTTCTTACTCCAACCATTCTGG - Intergenic
995800554 5:115989246-115989268 GCTTCTCTTACCAACCTCTCAGG + Intronic
998029593 5:138853983-138854005 GCTTCTTCTTCCATTCACCCAGG - Intronic
998266815 5:140673032-140673054 CCTAATTATGCCAACCACCCAGG - Intronic
998525302 5:142837409-142837431 TCCTCTTCTACCACCCACCCTGG + Intronic
999683033 5:154077398-154077420 GCTTCTTATAGCAACTCCCGAGG + Intronic
1002174142 5:177391873-177391895 GCTTCTTATACCAACCACCCTGG - Intronic
1003729927 6:8810121-8810143 GCACCTTCTACCAACCACCCTGG + Intergenic
1009533547 6:64851860-64851882 GTTTCTTGTACAGACCACCCAGG - Intronic
1015361791 6:132348286-132348308 CATTCATATAACAACCACCCAGG + Intronic
1018306591 6:162463432-162463454 GCTTCCTATACAAACCCCCTTGG - Intronic
1018778466 6:167041501-167041523 GCATTTTATAACAACCACACTGG - Exonic
1023314131 7:38917651-38917673 AATTCTGATACTAACCACCCGGG - Intronic
1024549205 7:50546898-50546920 GCTTCTTAAGCCAACGACCAAGG + Intronic
1028824968 7:95261105-95261127 ACTTCATATACAAACCACACTGG - Intronic
1032074580 7:128830375-128830397 GCTTCTTAAACCCCCCGCCCCGG + Exonic
1032958788 7:137005490-137005512 TATTCTTATCCCAACCATCCTGG + Intronic
1033611876 7:142971020-142971042 ACTCATTATACCAACAACCCTGG + Intergenic
1034406794 7:150909315-150909337 GCTTCTGCTACCAACCACAATGG - Intergenic
1044728404 8:95211339-95211361 TCTTCTTTAACCAACCACACAGG + Intergenic
1044807294 8:96021322-96021344 ACTTCTGAAACCTACCACCCTGG + Intergenic
1049582221 8:143418063-143418085 GCTTCCTAAACCACCCACCCAGG + Intergenic
1051541786 9:18228243-18228265 GCTTGTTATCCAAACCACGCAGG - Intergenic
1051639151 9:19208328-19208350 GCTTGTAATACCAGCTACCCAGG + Intergenic
1053262990 9:36686920-36686942 GCTTTATATTCCAGCCACCCTGG + Intergenic
1060000163 9:119951378-119951400 GCTTCATTTACCAAACCCCCAGG - Intergenic
1060480333 9:124013567-124013589 GCTTCTTAAATGAGCCACCCGGG - Intronic
1186495277 X:10008068-10008090 GCTTCTTAAACTAACAGCCCTGG + Intergenic
1187633430 X:21200625-21200647 GCTTTTTATTCCAGCCACACTGG - Intergenic
1191258457 X:58290007-58290029 GCATCTTATCCCAATCCCCCAGG - Intergenic