ID: 1002174361

View in Genome Browser
Species Human (GRCh38)
Location 5:177393217-177393239
Sequence CCTTATCCTCAGGGGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002174361_1002174372 24 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174372 5:177393264-177393286 TTGAGCTAAGGGTGTCTTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 84
1002174361_1002174370 13 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174370 5:177393253-177393275 GAGAATGGAGCTTGAGCTAAGGG 0: 1
1: 0
2: 1
3: 14
4: 148
1002174361_1002174369 12 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174369 5:177393252-177393274 GGAGAATGGAGCTTGAGCTAAGG 0: 1
1: 0
2: 2
3: 26
4: 240
1002174361_1002174368 -2 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174368 5:177393238-177393260 GGAATTGATCTAGAGGAGAATGG 0: 1
1: 0
2: 1
3: 21
4: 211
1002174361_1002174373 29 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174373 5:177393269-177393291 CTAAGGGTGTCTTGGAGGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 216
1002174361_1002174367 -9 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174367 5:177393231-177393253 AGGATAAGGAATTGATCTAGAGG No data
1002174361_1002174371 21 Left 1002174361 5:177393217-177393239 CCTTACACCCCCTGAGGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1002174371 5:177393261-177393283 AGCTTGAGCTAAGGGTGTCTTGG 0: 1
1: 0
2: 1
3: 7
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002174361 Original CRISPR CCTTATCCTCAGGGGGTGTA AGG (reversed) Intronic
900622737 1:3594873-3594895 CCTCAGCTTCAGTGGGTGTAAGG - Intronic
903888707 1:26555838-26555860 CCTTGTCCCCAGAGGGAGTAGGG - Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
910939202 1:92515034-92515056 CCTTCTCCCCAGGGGGAGTTGGG - Intronic
911521603 1:98936511-98936533 CCTGATCCTCAGGATGTGCATGG + Intronic
917586040 1:176426858-176426880 CCTTTTCCTAAGGGTATGTACGG + Intergenic
923519924 1:234727515-234727537 CCTGAACCACAGGGGGTATAAGG + Intergenic
923630432 1:235646036-235646058 CCTCATGCACAGGGGGTGTTGGG + Intronic
1064965835 10:21014329-21014351 CCTTACTCTCAGGGGGTTTATGG - Intronic
1067327544 10:45284203-45284225 CCTTGTCCTCTAGGGTTGTAAGG - Intergenic
1071038552 10:81278056-81278078 GCTGATCCCCAGGGGGTGAATGG + Intergenic
1071726644 10:88204900-88204922 CCTTACCCTAAAGGGGTGTTGGG + Intergenic
1074908607 10:117886954-117886976 CTTTGTCCTCAGGGAGTTTAGGG - Intergenic
1076715523 10:132362032-132362054 CCTTCCCCTCATGGGGTGTTGGG + Intronic
1078716323 11:13842416-13842438 CCATGTCCTTATGGGGTGTAAGG + Intergenic
1080755091 11:35189643-35189665 CCTCATCCCCAGGGTGTGTGGGG + Intronic
1085304785 11:75479161-75479183 CCTGATACTCAGGGTGTGTGAGG - Intronic
1088226501 11:107626234-107626256 CCCTCTGCTCAGGGGGTTTATGG - Intronic
1089623933 11:119739545-119739567 CCTTTTCCTCAAGGGGCTTAAGG - Intergenic
1090244326 11:125204926-125204948 GCTCATCCTCTGGGAGTGTACGG - Intronic
1092768685 12:11877179-11877201 GCTTATCCTCAGGGGCTTCAAGG + Intronic
1097522855 12:60689979-60690001 CCTTTTCCTGGGGGTGTGTAAGG + Intergenic
1097956752 12:65494736-65494758 CCTTTTACTCAGGGGGAGCAGGG + Intergenic
1100480220 12:94970672-94970694 CCTTATCCTAAGGGGGCTCATGG + Intronic
1103318812 12:120078246-120078268 GCTCATCCTCATGGGGTCTAGGG - Intronic
1107121355 13:36799813-36799835 CATTATCCTCAGGAGCTGGAAGG - Intergenic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1124804879 15:32871532-32871554 CCTTATTCTCATGGGGAGTCAGG + Intronic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1133970947 16:10567656-10567678 CCTTTTCCTCAGGGGGTCTTAGG - Intronic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1141223396 16:82092271-82092293 CCTTCTCCTCTTGGGGTGGAGGG - Intronic
1149664746 17:58357808-58357830 CCTTTTCCTCTGTGGGTGTCGGG + Exonic
1160979797 19:1811733-1811755 CCTTTTCCTCATGCGGTGAATGG - Exonic
1162622669 19:11856309-11856331 CCTTGTCCTCAGGGATTGTAAGG + Intronic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
927141499 2:20134296-20134318 CCATGTCTTCAGGGGGTCTAGGG - Intergenic
929718396 2:44337870-44337892 TCTTATCCGCAGGGGATGCAGGG - Intronic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
934950938 2:98575003-98575025 CCTTATCCCCAGGGGATGCCTGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936261029 2:110959682-110959704 CCTCATTCTCAGGGGGTGGCGGG - Intronic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946972174 2:225106117-225106139 CCTTATACTCAGGGCATGTTAGG + Intergenic
947890836 2:233617848-233617870 ACTTATCCTCAGGGGGCATGAGG + Exonic
947892449 2:233636663-233636685 ACTTATCCTCAGGGGGCATGAGG + Exonic
1168905515 20:1400471-1400493 CCTTGTCCTCAAGGGATGTAAGG - Intergenic
1171317411 20:24207112-24207134 CCTTATCCTCTGGGGGTGGGGGG + Intergenic
1171967629 20:31542414-31542436 CCTTCTCCCCTGGGGGTGGAAGG - Intronic
1173839270 20:46146552-46146574 CCTGATCCTCAAGGGCTCTAGGG + Intergenic
1175221054 20:57416660-57416682 CCTCATCCTCAGGGTGGGCAGGG + Intergenic
1181531031 22:23517570-23517592 CCTTGTCCTCACGTGGTGGAAGG - Intergenic
1183611182 22:38907457-38907479 CCTCCTGCTCAGGGGGTGTTAGG + Intergenic
950500241 3:13359100-13359122 CCTTATGGTCAGGAGGGGTAGGG - Intronic
955988156 3:64596843-64596865 CCTTGTCCTCAGTGGGCTTATGG - Exonic
957307948 3:78481935-78481957 CCTTTTCCTCAGGCTCTGTAAGG + Intergenic
962536918 3:136337626-136337648 CCATATCCACAGAGGGTGTGTGG + Exonic
969184102 4:5462825-5462847 CTTTATCCTCAGGGGATGCTTGG - Intronic
972934677 4:44118839-44118861 CATTATCCTCATGGGTTGTTGGG - Intergenic
974964871 4:68748191-68748213 CCTTGTCCTCAGGGATTGTAAGG + Intergenic
975490586 4:74984078-74984100 CTTTTTCCTCAGAGGGTGTCTGG + Intronic
984954307 4:185030469-185030491 CCTTATCCTCACCAGGTGAAGGG + Intergenic
986508783 5:8480761-8480783 CCTTCTCATAAGGGGGTGTGGGG - Intergenic
989405480 5:41056522-41056544 CCTCCTCCTCAGGGACTGTATGG + Intronic
990199123 5:53351542-53351564 CCTTATCCACAGGGGGGCTCTGG - Intergenic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
990992208 5:61697412-61697434 CCTTCTCCTTAGGGGGTCCAAGG + Intronic
993823143 5:92645809-92645831 CTTTATGCTCAGGGCGTGCATGG + Intergenic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1002779989 6:358541-358563 CCTCAGCCTCAGGGGTTGGAGGG - Intergenic
1003088679 6:3082583-3082605 CCTTATCCTCAGTGTGTCTTTGG + Intronic
1005934955 6:30514260-30514282 ACTGAACCTGAGGGGGTGTAGGG - Intergenic
1009047616 6:58248907-58248929 CCTTATCGAAAGGGGGTGTAGGG - Intergenic
1009223418 6:61003203-61003225 TCTTATCAAAAGGGGGTGTAGGG - Intergenic
1009877885 6:69528966-69528988 CCTTATGCTCAGGGTGTGTCAGG - Intergenic
1014191129 6:118498054-118498076 CATTACCTTCAGGTGGTGTAGGG + Intronic
1014412084 6:121137514-121137536 CCTTTTCCTCAGTGGTGGTAAGG - Intronic
1017812032 6:157990403-157990425 CCCTGTCCTCAGGGGGTGTGTGG - Intronic
1018756734 6:166856321-166856343 CCTTGTCCTCACGTGGTGGAAGG - Intronic
1030464515 7:109883036-109883058 CCTGATCCTTAGGGAATGTATGG + Intergenic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1034429149 7:151032229-151032251 CCTTCTCCTCAGAGGGAGTCAGG - Intronic
1034719854 7:153281342-153281364 CATTATCTTCAGGTGGTGTTAGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035101710 7:156402685-156402707 CCTTGTCCTCAGTGGGTTAATGG + Intergenic
1043336935 8:79187541-79187563 CCTTCTCCTCAATGGGTCTAAGG + Intergenic
1046493135 8:114979179-114979201 CCTTATCCTTAGGGTGGTTACGG + Intergenic
1049122334 8:140750386-140750408 CCTTATCCCCAGGGAGCTTAAGG + Intronic
1054744330 9:68839501-68839523 CCTAATCCACAGGGTGTTTAAGG - Intronic
1060473382 9:123967229-123967251 CCCTGTCCTCAAGGGGTCTACGG + Intergenic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1060880922 9:127117488-127117510 CCTTACCCTCAAGGGGTCCACGG + Intronic
1198315845 X:135465204-135465226 CCTTCTCCTCAGAGGCTGTAAGG + Intergenic
1201791817 Y:17849165-17849187 CCTTGTCCTTGGGGGTTGTAAGG + Intergenic
1201809737 Y:18056824-18056846 CCTTGTCCTTGGGGGTTGTAAGG - Intergenic