ID: 1002174764

View in Genome Browser
Species Human (GRCh38)
Location 5:177395526-177395548
Sequence AGCCTGGAGACCCCATGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002174764_1002174768 5 Left 1002174764 5:177395526-177395548 CCAGAGCATGGGGTCTCCAGGCT 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1002174768 5:177395554-177395576 CAGAGCCTGGACTTTATTGAGGG 0: 1
1: 0
2: 3
3: 20
4: 185
1002174764_1002174767 4 Left 1002174764 5:177395526-177395548 CCAGAGCATGGGGTCTCCAGGCT 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG No data
1002174764_1002174765 -8 Left 1002174764 5:177395526-177395548 CCAGAGCATGGGGTCTCCAGGCT 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1002174765 5:177395541-177395563 TCCAGGCTCTGCTCAGAGCCTGG 0: 1
1: 0
2: 6
3: 64
4: 532
1002174764_1002174770 30 Left 1002174764 5:177395526-177395548 CCAGAGCATGGGGTCTCCAGGCT 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1002174770 5:177395579-177395601 ACATGAGCACTCAGAAGACTTGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002174764 Original CRISPR AGCCTGGAGACCCCATGCTC TGG (reversed) Intronic
901013303 1:6213029-6213051 AGGATTAAGACCCCATGCTCTGG + Intronic
901604222 1:10446719-10446741 AGCCTTGACCTCCCATGCTCAGG + Intronic
902586799 1:17444389-17444411 AGCCTGGACTTCCCAGGCTCTGG - Intergenic
903812857 1:26044506-26044528 AGCAGGGAGACCACAGGCTCTGG + Intronic
904086444 1:27912751-27912773 ATTCTGGAGCCCCCATGTTCTGG + Intronic
904086881 1:27915549-27915571 AGCCTGGACACCCCAGGGCCAGG - Intergenic
904139191 1:28338641-28338663 AGCCTCGACATCCCAGGCTCAGG + Intergenic
904160323 1:28518229-28518251 GGCCTGCAGAGCGCATGCTCTGG + Intronic
904524463 1:31122326-31122348 AGCCTGGGGGCCCTAGGCTCTGG + Intergenic
905870519 1:41401582-41401604 ATCCTGGTAACCCCAGGCTCTGG + Intergenic
906510758 1:46409360-46409382 AGCCTGGAGATCCCTTGCCAGGG + Intronic
907479172 1:54732538-54732560 AGCCTCCAGCCCCCAGGCTCAGG + Intronic
909352124 1:74666153-74666175 AGCATGGTTTCCCCATGCTCTGG - Intronic
911563817 1:99438821-99438843 AGCCTGGAGCCCACAGGCTGGGG - Intergenic
912596038 1:110877351-110877373 AGCCTGCAGACACCATGGACAGG + Intronic
915933774 1:160078018-160078040 AGCCTTGAGCTCCCAGGCTCAGG + Intergenic
915983670 1:160441339-160441361 AGCCTCGACACCCCAGGCTCAGG - Intergenic
917854502 1:179089857-179089879 AGCCGGGAGACCCCTGTCTCGGG - Intronic
922565339 1:226597907-226597929 AGCCTGGGGTTCCCCTGCTCTGG - Intronic
922751777 1:228073460-228073482 ACCCGGGAGACCCCTTTCTCAGG - Intergenic
922801936 1:228368442-228368464 GGCCTGCAGGCCCCAGGCTCTGG - Intronic
1063037220 10:2298369-2298391 AGCCTGGACTTCCCAGGCTCAGG - Intergenic
1063129593 10:3166687-3166709 AGCCTGCAGCCCGCATGCTCAGG + Intronic
1063430270 10:5982101-5982123 AGCCTTGAGCTCCCAGGCTCAGG + Intergenic
1064313096 10:14229517-14229539 AGCCTCGACCTCCCATGCTCAGG + Intronic
1065316743 10:24471180-24471202 AGCCAAGAGACCCCATGATGTGG - Intronic
1067722582 10:48740438-48740460 ATCCTGGAGGCCCCAGGGTCAGG - Intronic
1069880863 10:71592242-71592264 AGCCAGGAGATCCAATGCTGAGG - Intronic
1070399682 10:76042395-76042417 AACCTGCAGACCCCTTGCCCAGG + Intronic
1072279693 10:93854504-93854526 AGCCTCGAATCCCCAGGCTCAGG + Intergenic
1072610394 10:97013948-97013970 AGCCCTGAGCCCCCATGCTCGGG - Intronic
1073622505 10:105063780-105063802 AGCCAGGAGACCTGATCCTCGGG + Intronic
1074927955 10:118092933-118092955 AGCCTGGACCTCCCAAGCTCTGG - Intergenic
1075045541 10:119143415-119143437 AGCCTTGACCTCCCATGCTCAGG + Intronic
1075532770 10:123244003-123244025 GGCCTGGAGACCCCAGGCCCTGG - Intergenic
1075902890 10:126057445-126057467 AGCCTGGAGACTCCAGGGTAAGG - Intronic
1075981740 10:126746276-126746298 AGCCTGGAGGCCCCATCCTAAGG + Intergenic
1076218964 10:128717859-128717881 AGGCAGGAGACTCCATGGTCAGG + Intergenic
1076270112 10:129145003-129145025 AACCCGGAGTCCCCATGTTCGGG - Intergenic
1076690775 10:132222949-132222971 AGGCTGGAGAGCCGGTGCTCGGG + Exonic
1077431522 11:2518169-2518191 TGCCTGGGGAGCCCCTGCTCTGG + Intronic
1079102619 11:17551343-17551365 TGTCTGGAGAGACCATGCTCTGG + Intronic
1080876563 11:36280022-36280044 AGCCTCGATGCCCCAGGCTCAGG - Intronic
1081460751 11:43270366-43270388 AGCCTCGACCTCCCATGCTCAGG - Intergenic
1081600487 11:44489320-44489342 GGCCAGTAGACCTCATGCTCTGG - Intergenic
1083466452 11:62849884-62849906 AGGCTGGAGTCTCCAAGCTCAGG + Intergenic
1086053405 11:82619978-82620000 AGCCTGGACTTCCCAGGCTCAGG - Intergenic
1087703281 11:101461488-101461510 AGCCTGGACCTCCCAGGCTCAGG - Intronic
1089129416 11:116200201-116200223 ATCCTGCAGACCCCACGCCCAGG - Intergenic
1089330063 11:117682842-117682864 AGCCAGGAGACAGCAGGCTCAGG - Intronic
1089348723 11:117809173-117809195 TGCCCTGAGACCCCAGGCTCAGG + Intronic
1089561468 11:119345419-119345441 AGCCTGAAGGCCCCCTCCTCAGG - Exonic
1089884188 11:121803508-121803530 GGCCTGCAGACCCAAGGCTCAGG - Intergenic
1090450029 11:126798111-126798133 TGCCTGGAGCCCCCAGGCACAGG - Intronic
1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG + Intergenic
1091050554 11:132365852-132365874 AGCATGGAGACCCCAGACTAAGG - Intergenic
1091193812 11:133715513-133715535 TGCCCACAGACCCCATGCTCAGG - Intergenic
1091246385 11:134099117-134099139 AGCCTCGAAACCCCAGGCTCAGG - Intronic
1091361538 11:134981949-134981971 AGCCTGGTGCCCCTAAGCTCAGG + Intergenic
1091520489 12:1235275-1235297 AGCCTTGACCCCCCAGGCTCAGG - Intronic
1091688779 12:2581911-2581933 GCCCTGGAGAGCCCATGCCCGGG + Intronic
1092218468 12:6698000-6698022 AGCCTGGAGACCACATTCCCTGG - Intronic
1092283117 12:7112359-7112381 AGGGTGGAGACCCGCTGCTCTGG - Intergenic
1092533252 12:9362738-9362760 AGCCTGGACTTCCCAGGCTCAGG + Intergenic
1094620973 12:32079899-32079921 AGCCTGGACCTCCCAGGCTCAGG + Intergenic
1095136887 12:38615532-38615554 AGCCTTGACATCCCAGGCTCGGG - Intergenic
1096621812 12:52870037-52870059 AGCCCAGAGTCCCCATTCTCTGG + Intergenic
1098308629 12:69125968-69125990 AGCCCAGAGAGCCCAAGCTCTGG + Intergenic
1098895955 12:76061009-76061031 AGCCTCGACATCCCAGGCTCAGG - Intronic
1098950816 12:76638982-76639004 AGGCTGGAGAGTCCAAGCTCAGG + Intergenic
1100760777 12:97804558-97804580 AGCCTGCAGCCCCTCTGCTCTGG - Intergenic
1100872356 12:98923311-98923333 ATCCTGGAAACCCCAAGCTTAGG - Intronic
1102261231 12:111444742-111444764 AGCCTGGACAGCTCAGGCTCTGG - Intronic
1102383148 12:112484458-112484480 GGCCAGGAGTCCCCGTGCTCTGG - Intronic
1103509132 12:121462275-121462297 CGCCTGTAGACTCCAGGCTCTGG + Intronic
1103939419 12:124493832-124493854 AGCTTGGAGCCCCGATGCTGTGG + Intronic
1104248789 12:127069576-127069598 AGCCTGGACCTCCCAGGCTCTGG + Intergenic
1105052833 12:133070092-133070114 AGCCTCGACATCCCAGGCTCAGG + Intergenic
1106264820 13:28100516-28100538 GGCCTGGGGACCCCGGGCTCCGG - Exonic
1106557794 13:30825185-30825207 ATCCTGGGGAGCCCATGGTCTGG - Intergenic
1112449929 13:99499108-99499130 AGCCTAGAGACCGCAGGCGCGGG - Intergenic
1112764983 13:102731933-102731955 ATCCTTGAGACATCATGCTCTGG + Exonic
1113389161 13:109879450-109879472 AGCCTCCAGACCAGATGCTCAGG - Intergenic
1113596982 13:111540277-111540299 AGCCTCCAGGCACCATGCTCAGG - Intergenic
1116686094 14:48040556-48040578 AGCCTGGTTGCCCCATCCTCAGG + Intergenic
1118327063 14:64788489-64788511 ACCATGAAGACCCCGTGCTCTGG + Intronic
1118747593 14:68785403-68785425 GGCCTGGAGGCCTCATTCTCAGG - Intergenic
1119423872 14:74523773-74523795 TGCCTGAAGCCCACATGCTCAGG + Intronic
1119847048 14:77838476-77838498 AGCCTGGACTTCCCAGGCTCAGG + Intronic
1121699076 14:95938378-95938400 GGCCTGGAGACCACATGCCCAGG + Intergenic
1122386141 14:101349429-101349451 AGCCTGGAGCACGCATGCTTGGG - Intergenic
1122945558 14:105007024-105007046 GGCCTGTAGACGCCAGGCTCGGG - Intronic
1125833907 15:42734694-42734716 AGCCTGGACCTCCCAGGCTCAGG + Intronic
1126329515 15:47516819-47516841 ACCCTGGGGACACCAGGCTCTGG - Intronic
1126593536 15:50363464-50363486 AGCCTGGATTTCCCATGCTCAGG + Intergenic
1126949697 15:53867910-53867932 AGCCTGGATCTCCCAGGCTCAGG + Intergenic
1129140771 15:73596037-73596059 TGTCTGGAGTTCCCATGCTCTGG + Intronic
1129565001 15:76612317-76612339 AGCCTGGACCTCCCAGGCTCAGG + Intronic
1129740177 15:77986212-77986234 AGGCTGGAGAGCCCAAGATCTGG - Intronic
1132433746 15:101780468-101780490 AGCCTTCTGACTCCATGCTCTGG + Intergenic
1132692610 16:1188347-1188369 ACCCTGGAGACCGCTGGCTCTGG + Intronic
1133928408 16:10212286-10212308 AGCCTCGAGCTCCCAGGCTCAGG - Intergenic
1135348985 16:21713043-21713065 AGCCTTGACCCCCCAGGCTCAGG + Intronic
1135554505 16:23424817-23424839 AGCCTGGTGAGCTCCTGCTCGGG + Exonic
1136282642 16:29222747-29222769 AGCCTGGAGACCCGTGGCACTGG - Intergenic
1136397713 16:30002121-30002143 CCCCTGGCGTCCCCATGCTCTGG - Intronic
1136416450 16:30107186-30107208 ACCCTCGAAACCCCGTGCTCAGG + Intronic
1137350843 16:47712794-47712816 AGCCTGGCCACCCACTGCTCAGG + Intergenic
1137393727 16:48102365-48102387 AGCTTTGAGCCCCTATGCTCAGG + Intronic
1138124666 16:54428890-54428912 AGCCTGGGGACAGCATTCTCAGG - Intergenic
1138681092 16:58684261-58684283 AGCCTGATGCCCACATGCTCAGG + Exonic
1139570371 16:67807858-67807880 AGCCTGGAGAGATCATCCTCTGG + Intronic
1139578926 16:67860354-67860376 AGCCTGGACCTCCCAGGCTCAGG + Intronic
1139960165 16:70712915-70712937 AGGCTGGAGCACCCATGCCCTGG - Intronic
1141487177 16:84348178-84348200 AGCCTCGACCCCCCAGGCTCAGG + Intergenic
1141488417 16:84355899-84355921 AGCCTGGAATTCCCAGGCTCAGG + Intergenic
1142087017 16:88188672-88188694 AGCCTGGAGACCCGTGGCACTGG - Intergenic
1142611139 17:1109645-1109667 ACCCCGGAGTCCCCATGCGCCGG + Intronic
1142672127 17:1492086-1492108 AGCCTGGAGCTTCCATGCCCTGG + Intronic
1143097870 17:4488120-4488142 AGGCTGGAGACCCCAGGCTGGGG - Exonic
1144774015 17:17775283-17775305 AGCCTGGACCTCCCAGGCTCAGG + Intronic
1146616137 17:34358794-34358816 AGCCAGGAGCGCCCATGCTGGGG - Intergenic
1147316297 17:39621994-39622016 CACCTGGAGACCCCCTGCTCTGG - Intergenic
1147456490 17:40541518-40541540 AGCCTGGTGGCCCCATACCCTGG - Intergenic
1147888324 17:43699394-43699416 AGCCTGGAGCTGCCCTGCTCGGG - Intergenic
1147909049 17:43843857-43843879 AGCCTCGACCTCCCATGCTCAGG + Intergenic
1147952600 17:44115454-44115476 AGCCTGGAAACCACATGCCTTGG - Intronic
1148070487 17:44905908-44905930 AGCCTGGAGGCCGGGTGCTCAGG - Intronic
1148169272 17:45505599-45505621 CGCCTGTAGACCCCCAGCTCTGG + Intergenic
1149833477 17:59891881-59891903 AGCCTGGACCTCCCAGGCTCAGG - Intronic
1150158313 17:62872456-62872478 AGCCTGGACTTCCCAGGCTCAGG - Intergenic
1150400465 17:64852062-64852084 CGCCTGTAGACCCCCAGCTCTGG + Intergenic
1150476959 17:65482937-65482959 AGCCTGGAGCCCCCAGAATCTGG - Intergenic
1150603886 17:66675152-66675174 AGGCTGGAGACTCCAAGTTCAGG + Intronic
1151460607 17:74252121-74252143 AGCCAGGAGACCCCAGGTCCAGG + Intronic
1152676776 17:81645302-81645324 TGCCCGCAGACCCCATGCTGGGG + Exonic
1152903010 17:82956203-82956225 AGCCTGGACTCCCCACGCTTGGG + Intronic
1153779668 18:8483418-8483440 ATCCTGGACATCCCAGGCTCAGG + Intergenic
1154493766 18:14940979-14941001 AGCCTGGTGACCCTAAGCTCAGG - Intergenic
1155412922 18:25565909-25565931 AGCATGGAGGCCCCAGGCTGAGG - Intergenic
1156904793 18:42339957-42339979 AGCCTCGAACCCCCAGGCTCAGG + Intergenic
1157222086 18:45835817-45835839 CACCTGGAGCCCCCAGGCTCAGG + Intronic
1157477839 18:48034820-48034842 AGCCTGGAGAGCTCATCGTCGGG + Intronic
1158033465 18:52995645-52995667 AGGCTGGAGACACCATTCTAGGG - Intronic
1160098905 18:75902394-75902416 AGGCTGGAGTCCCCATGGTCAGG + Intergenic
1160246724 18:77165494-77165516 GGCCTGGTGACCCCTTCCTCGGG - Intergenic
1160248734 18:77182749-77182771 AGAATGGATACCCCATTCTCTGG - Intergenic
1160936660 19:1599338-1599360 AGCCTGGAGAACCCACTCTTCGG + Intronic
1161021846 19:2014649-2014671 ACCCTGAATACCCCATCCTCAGG - Intronic
1161204940 19:3036104-3036126 TTCCTGGAGCCCCCAGGCTCGGG - Intronic
1161518861 19:4712467-4712489 AGCCTGGAAATCCCTGGCTCAGG - Intronic
1162370816 19:10278113-10278135 AGCCTGGACCTCCCAGGCTCAGG - Intronic
1162817807 19:13207178-13207200 AGCCGGGAGACCCCAGACTCTGG - Exonic
1163170687 19:15529023-15529045 AGCCTTGACATCCCAAGCTCAGG + Intronic
1163480486 19:17552991-17553013 AGCCTTGAGTTCCCAGGCTCAGG - Intronic
1163777388 19:19226512-19226534 GACCTAGAGACCCCATCCTCTGG + Exonic
1163829631 19:19541458-19541480 AGCCTGGAGGACCCAAACTCTGG + Intronic
1164966727 19:32490967-32490989 AGCCTTGATATCCCAGGCTCAGG - Intergenic
1165201115 19:34145612-34145634 ACCCTGCAGACCCCGTGCTTGGG + Intergenic
1167689049 19:50974593-50974615 AGCCTGGAGATCCCTGGCCCTGG - Intergenic
925523260 2:4771711-4771733 AGCCTGGACCTCCCAGGCTCAGG + Intergenic
925737769 2:6979207-6979229 AGACTGAAGACCACAGGCTCAGG - Intronic
926166706 2:10525620-10525642 CACCTGGAGACCCCAGACTCGGG - Intergenic
926212796 2:10883565-10883587 AGCCTGCTGACCCCAGGCTTTGG + Intergenic
926460052 2:13117941-13117963 AGCCTGGCCACTCCATGCTGGGG - Intergenic
927206312 2:20613300-20613322 GGCCTGCAGCTCCCATGCTCCGG + Intronic
928407073 2:31022951-31022973 AGTCTGGAGACCCCAAGCAAAGG + Intronic
929288302 2:40161326-40161348 AACCTGGAGACTCCATTATCTGG - Intronic
929454504 2:42056238-42056260 TGCCTGGAGAGCCCCAGCTCTGG - Intronic
929574773 2:43044476-43044498 AGACAGGAGGCCCCAAGCTCGGG - Intergenic
929876085 2:45797687-45797709 TGGCTGGAGTCCACATGCTCAGG + Intronic
930971866 2:57406177-57406199 AGCCTGGAGTGCTCAAGCTCTGG + Intergenic
931726790 2:65119121-65119143 AGCCTGGACTTCCCAGGCTCTGG - Intronic
931735777 2:65192472-65192494 AGCCTTGACATCCCAGGCTCAGG - Intergenic
934848399 2:97678894-97678916 AGCCTGGACTTCCCAGGCTCAGG - Intergenic
935361445 2:102250054-102250076 AGCCTGGAGACGCCAGGTTTCGG - Intergenic
935694543 2:105760280-105760302 ATTCTGGAAACCCCATGCTGGGG - Intronic
938614137 2:132980069-132980091 AGCCTGGACCTCCCAGGCTCAGG + Intronic
938657453 2:133448719-133448741 AGCCTTGACCCCCCAGGCTCAGG + Intronic
939024529 2:136996421-136996443 AGCCTGAAACCCCCAGGCTCAGG + Intronic
940986310 2:160055602-160055624 AGCCTTGTGACCCCATGGTGTGG - Intronic
945206577 2:207339160-207339182 ATCCTGGAGAACCCCTGCTCTGG + Intergenic
947425766 2:229981618-229981640 AGCCTGGACCTCCCAGGCTCAGG - Intronic
947603521 2:231468915-231468937 AGCCTCGACATCCCAGGCTCAGG + Intronic
948827254 2:240578648-240578670 AGGCTGGAGGCCCCAGGCTCTGG - Exonic
948909984 2:240998216-240998238 AGCCTGGCGTCCCCATGCTCAGG + Intergenic
1169585233 20:7074575-7074597 AGCCTTGAAACCCCTGGCTCAGG + Intergenic
1170183284 20:13557660-13557682 AGCCTTGACACCCCAGACTCAGG + Intronic
1170591196 20:17773210-17773232 AGCCTGGACCTCCCAGGCTCAGG - Intergenic
1170892037 20:20384244-20384266 ACCATGGAGACCCCATCCCCAGG + Intergenic
1171184878 20:23118102-23118124 AGCCTGCAGGCCCCATGCCAGGG - Intergenic
1171283837 20:23922097-23922119 AGCCTAGAGTCCCCCAGCTCTGG - Intergenic
1172020366 20:31909634-31909656 ACCCTGCAGCCTCCATGCTCTGG - Intronic
1172098547 20:32472625-32472647 AGGCTGGAAACCCACTGCTCTGG + Intronic
1172618855 20:36306873-36306895 AGCCTGGAAGCCCCCTCCTCAGG + Intronic
1172917885 20:38457455-38457477 AGCTTGGATCCCCCATTCTCTGG + Intergenic
1173732164 20:45336628-45336650 AGCCAGGAGTCTCCATGCACAGG + Intronic
1174121595 20:48269783-48269805 CCCCCGCAGACCCCATGCTCTGG - Intergenic
1174263462 20:49314245-49314267 AGCCTGGACCTCCCAGGCTCAGG - Intergenic
1175614111 20:60378017-60378039 AGATTGGAGACCCCATTCACAGG - Intergenic
1175888361 20:62304756-62304778 AGCCTGGAGCCTCCGTACTCTGG - Intronic
1175960035 20:62631318-62631340 AACCTGGTCACCCCGTGCTCTGG - Intergenic
1176207115 20:63895208-63895230 AGCCTGGAGACCCCGGGCGGCGG - Exonic
1179044191 21:37830283-37830305 AGCCTGGAGACCACAGGCCTAGG + Intronic
1179136679 21:38685689-38685711 AGCAAGGAGCCACCATGCTCAGG + Intergenic
1179238782 21:39570040-39570062 AGCCTGGACCTCCCAGGCTCAGG - Intronic
1179592569 21:42419073-42419095 AGCCTTGAGACCCCGAGCTGAGG - Intronic
1179999045 21:44986912-44986934 AGCCCGTGGACCCCAGGCTCCGG + Intergenic
1181270840 22:21657687-21657709 CCCCTGGTGACCCCACGCTCCGG + Intronic
1181455356 22:23057154-23057176 AGCCTTGACCTCCCATGCTCAGG + Intergenic
1181712677 22:24700494-24700516 AGCCTGGAGACCCCCAGCCCAGG + Intergenic
1181882191 22:25989935-25989957 AGCCTGGGGGCCCCAACCTCGGG + Intronic
1182364780 22:29771220-29771242 AGGCTGGTGCCACCATGCTCAGG - Intergenic
1183525242 22:38318720-38318742 TGGCTGGTGACCCCCTGCTCTGG - Intronic
1183667249 22:39253143-39253165 AGGCTAGAGACCCCAGGCGCCGG + Intergenic
1183962529 22:41420315-41420337 AGCCTGGAACTCCCAGGCTCAGG - Intergenic
1184478616 22:44734967-44734989 AGCCTGGAGCCACCAAGCTCGGG + Intronic
1185015380 22:48339647-48339669 GGCCTGAAGACCCCCAGCTCAGG - Intergenic
1185186174 22:49401784-49401806 AGACTGGCGACCCCAGGCCCGGG - Intergenic
949484182 3:4521786-4521808 AGCCTGGAACTCCCAGGCTCAGG - Intronic
950004499 3:9682954-9682976 AGCCTGTGGACCCCCTACTCGGG - Intronic
950654271 3:14427047-14427069 AGCATTGTGACCTCATGCTCAGG + Intronic
950892285 3:16414775-16414797 TGCCTGGAGAGCTCATGCCCTGG - Intronic
950898994 3:16479622-16479644 AGACCGGTGAGCCCATGCTCAGG + Intronic
951520118 3:23603577-23603599 AGCCTCGACATCCCAGGCTCAGG + Intergenic
952282981 3:31940998-31941020 AACTTGGAGACCCTGTGCTCAGG - Intronic
953407434 3:42666371-42666393 AGCCTGGAGTCCCCAGCCTTGGG - Intergenic
954498125 3:50983909-50983931 AGCCTGGAGACACCAAGAACAGG - Intronic
954782903 3:53073778-53073800 AGCCAGTATACCCAATGCTCGGG + Intronic
955541420 3:59980612-59980634 AGCCTGGAGAAGCCATGGCCAGG + Intronic
955737262 3:62052611-62052633 AGCCTGGAACTCCCAGGCTCAGG - Intronic
957153230 3:76513479-76513501 AGCCTGTAGACCAGCTGCTCAGG - Intronic
957695523 3:83633977-83633999 AGCCTTGACCGCCCATGCTCAGG - Intergenic
962468034 3:135678692-135678714 AGCCGGGAGCCCCCCTTCTCAGG - Intergenic
966525044 3:180911443-180911465 AGCCTGGACTTCCCAGGCTCAGG - Intronic
969117401 4:4879516-4879538 AGCCTGGACTTCCCAGGCTCAGG + Intergenic
969424607 4:7116829-7116851 AGCCTGCAGACCCCATTCAAAGG + Intergenic
970323254 4:14896687-14896709 ACCCTGGATACCCAAAGCTCAGG + Intergenic
971920496 4:32933191-32933213 ATCATGGAGACCCCATCTTCGGG + Intergenic
972920831 4:43939097-43939119 AGCCTTGATCCCCCAGGCTCAGG - Intergenic
973604786 4:52575675-52575697 AGCCTGGACCTCCCAGGCTCAGG - Intergenic
974011055 4:56607707-56607729 AGCCGGGAGCCACCATGCCCAGG - Intergenic
976648547 4:87410688-87410710 AGGCTGGAGTCTCCAGGCTCAGG + Intergenic
977244734 4:94618068-94618090 AGCCTGGACAGCCCAACCTCTGG + Exonic
979547941 4:121957979-121958001 AGCCTTGACAGCCCAGGCTCAGG - Intergenic
981521920 4:145671564-145671586 AGCCTCGAGCTCCCAGGCTCAGG + Intergenic
982120385 4:152137595-152137617 ACCCTTGAGACGCCCTGCTCAGG + Intergenic
985389241 4:189478064-189478086 AGCCTGGAGCCCCTGGGCTCAGG - Intergenic
985598987 5:815240-815262 ACCCTGCAGACACCGTGCTCTGG + Intronic
985599910 5:822346-822368 ACCCTGCAGACACCGTGCTCTGG + Intronic
985825536 5:2188038-2188060 ATCCTGCAGACCCCAGGCTCTGG - Intergenic
986195752 5:5535355-5535377 AGCCTGGAGACTCCTTCTTCAGG + Intergenic
986336377 5:6758794-6758816 AGTCTCGGGACCCCATGCGCTGG + Intergenic
986662403 5:10071109-10071131 GGCCTGGACACCCCAGGCCCTGG - Intergenic
987057607 5:14209914-14209936 ACCCTGGGGACCCCATTCTGGGG - Intronic
988267903 5:28974801-28974823 AGCCTGCAGACCACATGTTGTGG - Intergenic
992997578 5:82348091-82348113 AGCCTTGAACCCCCAGGCTCAGG + Intronic
998216516 5:140241760-140241782 AGCCTGGCCACCCCAGGCCCTGG - Intronic
999531523 5:152468143-152468165 AGCCTTGACCTCCCATGCTCAGG - Intergenic
1001185123 5:169563576-169563598 AGCCAGCAGTTCCCATGCTCAGG + Intergenic
1001571339 5:172732498-172732520 AGCCTGGAGACCCCCATCCCTGG + Intergenic
1001715124 5:173809055-173809077 AGCCTTGACATCCCAGGCTCAGG - Intergenic
1002098047 5:176843737-176843759 GCCCTGGAGCCCCCCTGCTCAGG + Intronic
1002174764 5:177395526-177395548 AGCCTGGAGACCCCATGCTCTGG - Intronic
1002344776 5:178540843-178540865 AGCCTGGACCTCCCAAGCTCAGG - Intronic
1003667751 6:8127347-8127369 AGCCTTGACAACCCAGGCTCAGG - Intergenic
1004122799 6:12841022-12841044 AGCCAGGAGACCCCGTCCTGCGG - Intronic
1004717955 6:18236964-18236986 AGCCTGTAAACCCAGTGCTCTGG + Intronic
1006529133 6:34635444-34635466 AGCCTTGACATCCCAGGCTCAGG - Intronic
1006620490 6:35360585-35360607 TACCTGGAGAGCCCATGCTGAGG - Intronic
1006784506 6:36656752-36656774 ACCCTGGATACCCAAAGCTCGGG + Intergenic
1007368435 6:41410237-41410259 AGACTGGAGACACCTGGCTCTGG - Intergenic
1011733414 6:90289780-90289802 AGGATGGAGACCCTCTGCTCTGG + Intronic
1013306021 6:108847880-108847902 AGCCTGGCGTCCCCATCCACAGG - Intergenic
1015685219 6:135851443-135851465 AGCCTGGGCACCCCACTCTCAGG - Intergenic
1016657774 6:146541973-146541995 AGCCTGGACCTCCCAGGCTCAGG + Intergenic
1017485869 6:154901252-154901274 TGCCCTGAGACCCTATGCTCTGG + Intronic
1018641569 6:165908700-165908722 ATGCTGGAGTCCCCATGTTCTGG - Intronic
1019338059 7:494458-494480 AGCCTGGGGTCCCCGTTCTCAGG + Intergenic
1019504742 7:1385284-1385306 AGCCAGGTGACCACATCCTCCGG - Intergenic
1019563607 7:1669457-1669479 AGCCTCGGGACTCCACGCTCGGG - Intergenic
1019659742 7:2217486-2217508 AGCCTCCAGACCCTGTGCTCTGG - Intronic
1020166189 7:5809354-5809376 AGCCTGGACCTCCCAGGCTCAGG + Intergenic
1020331253 7:7019305-7019327 AGCCTTGACATCCCAGGCTCAGG + Intergenic
1022455720 7:30556635-30556657 ACCCTGGAGATGCCATCCTCTGG + Intergenic
1023605418 7:41926881-41926903 AGCCTGGACCTCCCAGGCTCAGG + Intergenic
1025767299 7:64467631-64467653 AGCCTGGTGACTCCAAGCTAGGG + Intergenic
1025912913 7:65841857-65841879 AGCCTGGAGAGGCCATTGTCAGG - Intergenic
1025996421 7:66530207-66530229 CGCCTGGCCACCCCAGGCTCAGG - Intergenic
1026368160 7:69670780-69670802 AGCCTTGAGTTCCCAGGCTCAGG - Intronic
1026831448 7:73612710-73612732 AGCCCAGAGACCCCATCCTCTGG + Intronic
1026905173 7:74058784-74058806 GGCCTACAGACCCCATGCCCAGG - Intronic
1027266321 7:76496994-76497016 ACCCAGGAGACCCCGTGCCCCGG + Intronic
1027317701 7:76995112-76995134 ACCCAGGAGACCCCGTGCCCCGG + Intergenic
1029424795 7:100488769-100488791 AGCCTTGAGACCCCATCGCCAGG - Exonic
1032360522 7:131250577-131250599 AGCCTTGTGACCCAAGGCTCTGG - Intronic
1032787282 7:135211138-135211160 AGGCTGGAGCCCCGATGCCCCGG - Intronic
1034398465 7:150845918-150845940 AGCCAGGTGACCCCAAGTTCGGG - Intronic
1034497388 7:151431015-151431037 GTCCAGGAGCCCCCATGCTCAGG + Intronic
1035661702 8:1352890-1352912 AGACCGGAGGCCCCATTCTCAGG - Intergenic
1035825607 8:2641474-2641496 AGCCTGGGGATCGCATGGTCAGG + Intergenic
1037103577 8:15078002-15078024 GGACTGGAGGCCCCATGCACTGG + Intronic
1037579013 8:20233711-20233733 GGCCTGTAGACCCAAGGCTCCGG + Intergenic
1037722442 8:21456215-21456237 AGGCCTGAGACCCCAAGCTCAGG + Intergenic
1037938008 8:22928148-22928170 AAGCTGGTGACCCCAGGCTCAGG + Intronic
1038553988 8:28494029-28494051 CGCCTGGAGCTCCCTTGCTCCGG - Intergenic
1038716623 8:29996961-29996983 AGCCTGTGGACCCAATGCTGAGG + Intergenic
1040046584 8:42970867-42970889 AGCCTCGACCCCCCAGGCTCAGG + Intronic
1040595657 8:48835184-48835206 AGCCTGCAGACGCCACGCCCGGG - Intergenic
1042106962 8:65338392-65338414 AGCATGGTAACCCCTTGCTCTGG - Intergenic
1042455649 8:68999362-68999384 AGCCTTGAGCTCCCAGGCTCAGG - Intergenic
1045062683 8:98423033-98423055 GGTCTGGAGCCCCCAGGCTCTGG - Intronic
1047948089 8:129902596-129902618 GGCCTGGACATCCCAGGCTCAGG + Intronic
1049113075 8:140661733-140661755 CCCCTTGAGACCCCCTGCTCTGG - Intronic
1049614109 8:143568883-143568905 AGCCTGGAGAGCCCCTGCAGGGG + Intronic
1051891843 9:21950331-21950353 AGCCTTGAGCTCCCAGGCTCAGG - Intronic
1052251066 9:26397950-26397972 AGCCAGGAGATCCCATGCAAAGG - Intergenic
1052736165 9:32344767-32344789 GTCCTGGAGGCCCCCTGCTCAGG + Intergenic
1053394256 9:37758328-37758350 AGCCTTGACCTCCCATGCTCGGG - Intronic
1055568023 9:77588495-77588517 AGCCTGGAGAGCAGATGCTTAGG + Intronic
1057216680 9:93232430-93232452 ACCGTGGAGAGCCCATGCCCAGG + Intronic
1057293308 9:93820629-93820651 GGCCTGGAGACCCCATCCCCTGG - Intergenic
1057864042 9:98665185-98665207 AGCCTGGACCTCCCAGGCTCAGG - Intronic
1058678842 9:107424163-107424185 AGCCTCGAATCCCCATGCTCAGG - Intergenic
1059429597 9:114241956-114241978 AGCCTGGAGTCTCCATTCACTGG + Intronic
1061486375 9:130922533-130922555 AGCCTGGAGGTTCCACGCTCTGG - Intronic
1061551442 9:131337055-131337077 AGCTTGGACACTCCTTGCTCTGG - Intergenic
1061895230 9:133643605-133643627 AGGCAGGAGACACCATGCTGGGG - Intronic
1062031430 9:134363763-134363785 GCCCTGGGGTCCCCATGCTCAGG - Intronic
1062148121 9:135001959-135001981 TGCCTGGAGCGCCCATCCTCCGG - Intergenic
1062211181 9:135365130-135365152 AGCCTGGAGCCCCACTGCTGAGG - Intergenic
1185484929 X:474968-474990 AGCCTGGAGCCCCCAGGAGCTGG - Intergenic
1185762369 X:2698546-2698568 AGCCTCGAACCCCCAGGCTCAGG + Intronic
1186475964 X:9857918-9857940 AGGCTGTAGACCCCATCCTGAGG + Intronic
1186845247 X:13524319-13524341 AGACTTGAAACCCCATGCTGTGG - Intergenic
1188666100 X:32822782-32822804 AGTCGGAAGACCCTATGCTCAGG + Intronic
1189167031 X:38870508-38870530 AGCCAGGACAGCCCATCCTCAGG + Intergenic
1189377805 X:40479435-40479457 AGCCAGGACACCTCATGCCCAGG + Intergenic
1190370252 X:49733444-49733466 AGCCTTGAGTTCCCAGGCTCAGG - Intergenic
1193444235 X:81579508-81579530 AGCCTGGTGACTGGATGCTCTGG - Intergenic
1193721466 X:84991741-84991763 AGCCAGGAAAGCCCATGCTTGGG - Intergenic
1199141616 X:144320304-144320326 AGCCTTGACATCCCAGGCTCAGG - Intergenic
1200088599 X:153624010-153624032 AGCCTGGAGCCCCCAGGAGCTGG + Intergenic