ID: 1002174767

View in Genome Browser
Species Human (GRCh38)
Location 5:177395553-177395575
Sequence TCAGAGCCTGGACTTTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002174764_1002174767 4 Left 1002174764 5:177395526-177395548 CCAGAGCATGGGGTCTCCAGGCT 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002174767 Original CRISPR TCAGAGCCTGGACTTTATTG AGG Intronic
No off target data available for this crispr