ID: 1002175738

View in Genome Browser
Species Human (GRCh38)
Location 5:177400139-177400161
Sequence CGGCCAGCCAGGCCGCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175738 Original CRISPR CGGCCAGCCAGGCCGCCCAC TGG (reversed) Exonic
900166552 1:1246337-1246359 AGCCCAGCCAGGCCGGCCTCTGG - Intronic
900418821 1:2546888-2546910 CGCCCAGCAACCCCGCCCACAGG + Intergenic
900601821 1:3505983-3506005 GGCCCAGCCAGGTCACCCACTGG - Intronic
900775802 1:4584601-4584623 CGTCTAGCCAGGGCACCCACTGG + Intergenic
901643466 1:10704720-10704742 CAGCCAGCCAGCTCGCCCGCCGG + Intronic
902371943 1:16012988-16013010 CGGCCAGTCTGGGCGCCCAGGGG + Intergenic
903055568 1:20633761-20633783 CCGCCAGCCCGGCCACCGACTGG - Exonic
904295833 1:29519276-29519298 AGTCCAGCTTGGCCGCCCACTGG + Intergenic
904306330 1:29592591-29592613 CTGCCTGTCAAGCCGCCCACTGG - Intergenic
904744695 1:32703283-32703305 CAGCCACCCAGCCCGCCCCCAGG - Intronic
905044467 1:34985102-34985124 CGGCCCGGCAGGCCGCCTTCGGG - Intronic
907323397 1:53619687-53619709 CAACCCGCCAGGCGGCCCACAGG + Intronic
912763112 1:112386361-112386383 AGGCCAGCCGAGCCACCCACTGG + Intergenic
915319893 1:155051003-155051025 CTCCGAGCCAGGCCGCGCACAGG + Intronic
919939431 1:202276215-202276237 GGGCCAGCCAGGCCCTCAACAGG - Intronic
920205699 1:204289533-204289555 CGGCCAGCCAGCCACCCCGCGGG - Intronic
920397718 1:205659144-205659166 CGGCCAGCCCGGCAGCCCCATGG + Exonic
922423198 1:225472805-225472827 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
922730537 1:227946905-227946927 AGGCCAGCCAGGGCTCCCAGCGG + Intronic
922730762 1:227947851-227947873 CGGCCAGCCAGCGCGCCAGCGGG + Exonic
924634534 1:245773466-245773488 CTGCCAGCCAGGCTGCTCGCGGG - Intronic
1062908924 10:1199610-1199632 CTGCCCACCTGGCCGCCCACAGG - Intronic
1062982401 10:1736726-1736748 GTGCCAGCCCGGCCGGCCACTGG + Intronic
1063318744 10:5032780-5032802 CGGCCAGCCCTGCCGGCCCCGGG - Intronic
1067044468 10:42976472-42976494 CAGACAGCCAGGCTGCCCCCAGG + Intergenic
1067227800 10:44386687-44386709 CGGGGAGCCTGGCCGCTCACCGG + Intergenic
1069757707 10:70783183-70783205 CGGTCAGCCAGACCCCCCAATGG - Intronic
1070140267 10:73733232-73733254 CGGGCAGCCTGGGCGCCGACAGG - Intergenic
1070752584 10:78972931-78972953 AGGCCAGCCAGGCCGGGCCCTGG + Intergenic
1073057844 10:100713628-100713650 GGGCCAGCCTGGCCGCGCAGGGG + Intergenic
1075415353 10:122258561-122258583 CTTCCAGCCAGATCGCCCACAGG - Intergenic
1076126398 10:127977760-127977782 AGGCCAGTGAGGGCGCCCACAGG - Intronic
1076373920 10:129971386-129971408 CGGCCATCCGGGCCGCCCTCGGG + Intergenic
1076779710 10:132717409-132717431 GGGGCAGCCAGGCTGCTCACTGG - Intronic
1077250028 11:1556904-1556926 CGGGCAGCCCGGGCGCCGACAGG + Exonic
1077539205 11:3138742-3138764 CGGCCTGCAGGGCCGTCCACTGG - Intronic
1077976306 11:7252013-7252035 CAGCCGGCCCGGCCTCCCACCGG - Exonic
1080195208 11:29600408-29600430 CGGCCAGCCCTGCCGGCCCCGGG - Intergenic
1080557704 11:33432005-33432027 CGGCCTGCCATGCCGGCCCCGGG - Intergenic
1081528551 11:43943004-43943026 CGGCCCGCCAAGCTGCCCAAGGG + Exonic
1081896775 11:46593735-46593757 CGGCCAGCCTGCCCACCCGCCGG + Intronic
1083200398 11:61118050-61118072 GGGCAAGGCAGGCAGCCCACGGG + Intronic
1084334922 11:68451289-68451311 CTGCCAGTCAGGCCTCCCAAAGG - Intergenic
1084556922 11:69880977-69880999 GGGCCAGCCAGGCCACCTCCCGG - Intergenic
1086397762 11:86433783-86433805 CGGCCAGCCCTGCCGGCCCCAGG - Intergenic
1089599425 11:119604432-119604454 CTGCCAGCCAGGCCACCTGCTGG - Intergenic
1090042298 11:123301817-123301839 CGCCCAACCCGGCCGCCCCCCGG + Intergenic
1091320602 11:134646746-134646768 CTGCCAGGCAGGCCACCCAGGGG + Intergenic
1091629490 12:2148886-2148908 CCACCCGCCAGGCTGCCCACTGG - Intronic
1091802599 12:3334028-3334050 CGGCCAGCCAGGCCCTCGGCAGG + Intergenic
1092137417 12:6159575-6159597 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1094493873 12:30977454-30977476 CTGCCACCCAGGCTGCCCCCGGG - Intronic
1096494681 12:52033178-52033200 CGCCCAGCCCGGCCGCCCCCGGG + Intronic
1096647532 12:53047011-53047033 CGGCCAGCCGGGCCGCGCCAGGG - Intronic
1096677083 12:53231849-53231871 CGGCCAGCCTGGCCAGCCTCGGG + Intronic
1099973683 12:89525310-89525332 CGCCCAGCCAAGCCGCCGCCTGG - Intronic
1100585568 12:95976447-95976469 CGGACATCGAGGCAGCCCACAGG - Exonic
1100685556 12:96983237-96983259 CTGAAAGCCAGGCTGCCCACAGG - Intergenic
1101008977 12:100430400-100430422 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1101680113 12:106956159-106956181 TGGGCAGCCAGGCCGGGCACTGG - Intronic
1102298583 12:111755613-111755635 CTGCCACCCAGGCTGCCCTCGGG + Intronic
1103908125 12:124337706-124337728 CGCCCACCCTGGCCGCCCCCTGG - Intronic
1104858782 12:131914108-131914130 CGGCCAGGGTGGCCCCCCACTGG + Intronic
1105425631 13:20292515-20292537 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1107014205 13:35695675-35695697 AGGACAGGCAGGCCACCCACGGG - Intergenic
1113609081 13:111630632-111630654 AGGAGAGCCAGGCGGCCCACAGG - Intronic
1114658420 14:24329804-24329826 AGGCCAACCAGGCCTACCACAGG - Intronic
1121625671 14:95384059-95384081 GGGCCAGCCAGGCGGGCCTCTGG + Intergenic
1122884699 14:104705809-104705831 CGCCCTGCCAGGCTGCCCCCGGG - Intronic
1123000659 14:105292537-105292559 CAGCCAGCCAGGCCTCCTACAGG - Intronic
1124347198 15:28930788-28930810 AGCCCAGCAAGGCCTCCCACAGG - Intronic
1125522951 15:40358298-40358320 CGGACAGCGGTGCCGCCCACGGG + Exonic
1125604004 15:40929914-40929936 GGGCTCGCAAGGCCGCCCACTGG - Exonic
1126113251 15:45187658-45187680 CGGACATCCTGGCCGCCTACAGG - Intronic
1128247134 15:66140753-66140775 CTGCCAGGCTGGCCTCCCACCGG - Intronic
1128810301 15:70566541-70566563 CAGCCAGGCTGGGCGCCCACTGG - Intergenic
1129116692 15:73368696-73368718 CGGACAGCCAGCCCTCCCGCGGG - Exonic
1131153003 15:90058598-90058620 CTGACAGCCAGGCCACCCACAGG - Intronic
1132097699 15:99000148-99000170 CGGCCAGCCCCGCCGGCCCCAGG + Intronic
1132511005 16:341362-341384 CGGCCAGCCCTGCCGGCCGCGGG + Intronic
1132514311 16:359231-359253 TGGCCAGCCAGGCGGCCCAGAGG + Intergenic
1137323682 16:47411690-47411712 CAGCCCGCCAGGACCCCCACTGG + Intronic
1137733690 16:50708796-50708818 CTTCCAGCCACCCCGCCCACAGG - Intronic
1139125551 16:64072590-64072612 CGGCCAGCCCTGCCGGCCCCGGG - Intergenic
1139659576 16:68411557-68411579 TGGCCAGCAGGGCTGCCCACAGG + Intronic
1141443807 16:84045516-84045538 CCGCCTGCCCGCCCGCCCACCGG - Intergenic
1142163168 16:88569958-88569980 CGGGGAGCCAGGCAGCCCACGGG + Intergenic
1143368314 17:6422682-6422704 TGTCCAGCCAGGGAGCCCACAGG + Intronic
1144574231 17:16418801-16418823 CTGCCAGCCAGACTGTCCACAGG + Intronic
1146057644 17:29589276-29589298 CGCACAGCCAGGCCGCCGCCGGG - Intronic
1147440515 17:40444350-40444372 CCAGCAGCCAGGCCTCCCACTGG - Intronic
1147446683 17:40479053-40479075 CGGCCAGACTGGCTGACCACTGG - Intronic
1148910968 17:50942573-50942595 CGTCCAGGCAGGCTGCACACGGG - Intergenic
1151759055 17:76090442-76090464 GGGCCAGGCAGGCCGCCCCTTGG + Exonic
1152128106 17:78459561-78459583 AGGCCAGCCAGGCCCCACAGAGG - Intronic
1152611060 17:81315217-81315239 GGGCCAGCTGGGCAGCCCACGGG - Intronic
1156462562 18:37329561-37329583 CGGCCAGCCTGGGCTACCACAGG + Intronic
1156674690 18:39513620-39513642 CAGGAAGCCAGGCTGCCCACTGG + Intergenic
1157085956 18:44580832-44580854 CGGCCAGCCCTGCCGACCCCGGG + Intergenic
1157476882 18:48029319-48029341 CGGCCAGGCCGGCGGCCCAAGGG + Exonic
1157595100 18:48859568-48859590 GGGCCTGGCAGGCGGCCCACGGG + Exonic
1158351905 18:56572389-56572411 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1160873974 19:1288778-1288800 CGGCCAGCCAGACCACCCAACGG - Intronic
1161026835 19:2040827-2040849 TGGCCAGCCAGGCGGCTCCCAGG - Intronic
1161067998 19:2247932-2247954 CTGCCACCCATGCCCCCCACAGG + Exonic
1161080961 19:2309937-2309959 CTGCAGGCCAGGCCCCCCACAGG + Intronic
1161171325 19:2813767-2813789 CTGCCAGCCAGGCCGGCCTGGGG + Exonic
1161220124 19:3114570-3114592 GGGCCAGCCAGGCCTCTCTCGGG + Intronic
1161222419 19:3123693-3123715 CCGTCCGCCAGGCCGGCCACAGG - Exonic
1162244190 19:9385596-9385618 CGGAGAGCCAGGCCTGCCACAGG + Intergenic
1163667663 19:18610809-18610831 CCCCCAGCCAGGCCGCCCCGGGG + Intronic
1164389658 19:27806590-27806612 CTGCCAGCCAGGCTGCCTGCCGG + Intergenic
1164583514 19:29450180-29450202 AGGCCATCCAGGCCACACACTGG + Intergenic
1164975780 19:32571687-32571709 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1166049099 19:40247576-40247598 CACCCAGCCAGGGAGCCCACGGG + Intronic
1168056145 19:53866379-53866401 CAGCCAGCCAGGCCGCGCCCGGG + Intronic
1168318420 19:55494288-55494310 GGGCCAGCCAGGGCTGCCACGGG - Intronic
927488421 2:23504827-23504849 CGGCCAGAATGGCGGCCCACAGG - Intronic
927702611 2:25277431-25277453 GGGACCGCCAGGCCGCCCCCAGG - Intronic
927842971 2:26457014-26457036 TGCCCACCCAGGCTGCCCACAGG - Intergenic
928303566 2:30147445-30147467 CGGCCAGACCGTCCGCCCAGGGG - Intronic
928617955 2:33057689-33057711 CGGCCAGCCGTGCCGGCCCCGGG - Intronic
932623984 2:73284029-73284051 AGGCCCGCGAGGCCGCCCAACGG - Intronic
936962250 2:118088422-118088444 CGGCCAACGAGGCCGCGCGCAGG - Intergenic
937837085 2:126482685-126482707 CGGCCAGCGACACCACCCACTGG + Intergenic
938096671 2:128468405-128468427 CTCCCAGCCAGGCCTCCCTCAGG - Intergenic
940774993 2:157876026-157876048 CGGCCAGCCGCGCCGGCCCCAGG - Intergenic
944728583 2:202497009-202497031 CGGCCAGCCCTGCCGGCCCCAGG + Intronic
946360793 2:219218393-219218415 CGGCCAGCCAGGCCGGCCAGGGG + Exonic
946376496 2:219312919-219312941 CGGCCAGCCCCGCCGGCCCCGGG + Intergenic
947641522 2:231710020-231710042 CGAACAGCCAGGCCCCGCACTGG - Intronic
948423266 2:237873404-237873426 GGGGCAGCCGGGCCCCCCACAGG - Intronic
948935075 2:241158649-241158671 GAGGCAGCCACGCCGCCCACAGG - Intronic
1170999047 20:21395981-21396003 AGGGCCGCCAGGCCGCCCCCCGG + Exonic
1175225127 20:57440144-57440166 CAGGCAGCCAGGAGGCCCACAGG - Intergenic
1179712009 21:43268879-43268901 CGACCAGGCAGGTCCCCCACTGG + Intergenic
1179875233 21:44263531-44263553 GGGGCAGTCAGGCCGCCCAGCGG + Intergenic
1181632750 22:24159840-24159862 CTGCCAGCCACCCCGTCCACAGG + Intronic
1182340902 22:29620013-29620035 TGGCCACCCCGGCCTCCCACTGG - Intronic
1182448588 22:30404466-30404488 GGGCCAGACAGGCTGCCCTCTGG - Intronic
1185109791 22:48894521-48894543 CGCCCAGAATGGCCGCCCACAGG - Intergenic
1185371658 22:50463680-50463702 CGGCCCGCAAGGCCTCCCTCCGG - Intronic
950613702 3:14142089-14142111 CGGCCAGCCACTCAGCCCATTGG + Exonic
955161268 3:56467766-56467788 CGGCCAGCCACCCCACCCCCGGG + Intronic
955266473 3:57449607-57449629 CGGCCAGCCCTGCCGGCCCCGGG - Intronic
955973360 3:64458092-64458114 CGGCCAGCCAGGTCACCTAGGGG + Intergenic
956022765 3:64949758-64949780 AGGTCAACCAGGCCGCCTACAGG - Intergenic
957921804 3:86757696-86757718 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
961167479 3:124773615-124773637 GGTCCAGCCAGGCAGCCCTCAGG - Intronic
961202548 3:125056053-125056075 CGCCCAGCCAGCCCGGCCCCCGG - Intergenic
961825220 3:129595738-129595760 CAGCCAGCCAGGCCGCCCTGAGG + Intronic
966871232 3:184291598-184291620 CGGCCAGCCAGGGCCCACAAAGG + Intronic
967977688 3:195044606-195044628 GGCCCAGCCAGGCCTCCCCCTGG + Intergenic
968174030 3:196533602-196533624 CGGCCGTCCATGCCCCCCACCGG + Intergenic
968185158 3:196627979-196628001 CTTCCAACCAGGCCGCCCCCTGG - Intergenic
968742403 4:2337934-2337956 CTGCCAGCCAGGCCTACCCCAGG + Intronic
979825716 4:125229839-125229861 CGGCCAGCCCTGCCGGCCCCAGG - Intergenic
983533393 4:168832997-168833019 GGGCCAGCCTGGCTGCTCACGGG - Intronic
984708145 4:182862777-182862799 CAGCCTGGGAGGCCGCCCACTGG - Intergenic
985497724 5:218807-218829 AGCCCAGCCAGGGCGGCCACCGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985574453 5:667231-667253 CGGCCAGCCCCGCAGCCCAGGGG + Intronic
985866969 5:2521593-2521615 CAGCCAGGCTGGCAGCCCACAGG - Intergenic
988132147 5:27119998-27120020 CGGCCAGCCCTGCCGGCCCCGGG + Intronic
988279569 5:29127883-29127905 CGGCCAGCCCTGCCGGCCCCAGG - Intergenic
989126040 5:38053245-38053267 CGGCTCTCCAGGCAGCCCACAGG - Intergenic
996435678 5:123430647-123430669 CGGCCAGCCCTGCCGGCCCCAGG + Intergenic
998135368 5:139671546-139671568 CGGCCGGCTGGGCTGCCCACAGG + Intronic
998164869 5:139837171-139837193 CTTCCAGCCACGCCTCCCACGGG - Exonic
1000339916 5:160269139-160269161 CGGCCAGCTGGGTCACCCACGGG + Intronic
1002175738 5:177400139-177400161 CGGCCAGCCAGGCCGCCCACTGG - Exonic
1002636292 5:180610334-180610356 GGGCCAGCCAGGCAGCCCTGGGG + Intronic
1003070212 6:2939730-2939752 CGGCCGGCCATGCCGGCCTCGGG + Intergenic
1004036954 6:11933181-11933203 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1004140292 6:13011991-13012013 CTACCAGCCAGGCCAACCACAGG - Intronic
1004614867 6:17280761-17280783 CCGAGAGCCAGGCCGCCTACAGG + Intergenic
1005938865 6:30546109-30546131 CGGCCAGCCAGGCTGGACCCTGG + Exonic
1005977017 6:30807702-30807724 CGGCCAGCCCTGCCGGCCCCGGG - Intergenic
1006339311 6:33437950-33437972 CGCCCAGCCAGGGTGGCCACTGG - Exonic
1015096249 6:129417639-129417661 CTGCCATCCACGGCGCCCACTGG + Intronic
1015625922 6:135181161-135181183 CGGCCAGCCCGGCAGCCCCGCGG + Intergenic
1017537358 6:155363169-155363191 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1018901212 6:168052679-168052701 TGACCAGCCAGGCCTCCCGCTGG - Intergenic
1019323249 7:425070-425092 TGGCCAGCGAGGCCGTCCATGGG + Intergenic
1019578217 7:1747723-1747745 TGGCCACCCCGGCCGTCCACAGG - Exonic
1025639011 7:63349965-63349987 CCGCCGGCCAGGCCGCCTGCTGG + Intergenic
1025643688 7:63398127-63398149 CCGCCGGCCAGGCCGCCTGCTGG - Intergenic
1027044187 7:74980824-74980846 GGGCCAGGCAGGCAGCCCCCTGG + Intronic
1027079455 7:75221534-75221556 GGGCCAGGCAGGCAGCCCCCTGG - Intergenic
1029388676 7:100260117-100260139 GGGCCAGGCAGGCAGCCCCCTGG - Intronic
1032201638 7:129826230-129826252 TGGCCACCCAGTCCGCCCCCAGG + Intergenic
1032266448 7:130373517-130373539 CGGCCAGCCTGGCCTCACACAGG - Intergenic
1033823635 7:145163109-145163131 CAGCCAGCCAGGCCTCCTGCTGG + Intergenic
1035075237 7:156173500-156173522 GGGCCAGTCAGGCCTCCCAGAGG - Intergenic
1035444325 7:158929499-158929521 CGGCCAGAAAAGCTGCCCACAGG + Intronic
1040578390 8:48674484-48674506 CCGCCAGCCAGGCCTCCCTCAGG + Intergenic
1047124724 8:121948137-121948159 CGGCCAGCCCTGCCGGCCCCGGG + Intergenic
1049665797 8:143841895-143841917 CCTCCAGCCACGCCGACCACCGG + Intergenic
1049782444 8:144435139-144435161 CGGCCAGCCAGGCCACAGAGTGG + Exonic
1052358417 9:27529031-27529053 CCGTCAGCCAGGTCGCCCCCGGG - Intronic
1053011773 9:34637699-34637721 CGCCGTGCCAGGCCGCCCGCCGG - Exonic
1053298973 9:36935484-36935506 CAGCCTGCCAGGCCCCCCTCAGG + Intronic
1054907158 9:70421215-70421237 CAGCCAGGCAGGGCCCCCACAGG - Intergenic
1056944598 9:90983668-90983690 CGGCCAGCCAGGCCTTCCCCTGG + Intergenic
1057293123 9:93819657-93819679 TGGCCAGCCAGGCCACTCAGGGG + Intergenic
1060627417 9:125126288-125126310 CAGCCACCCAGGCAGCCCATGGG - Intronic
1060756333 9:126217199-126217221 CGGGCAGCAAAGCAGCCCACAGG + Intergenic
1060771028 9:126332451-126332473 CAGCCAGCCTGGGCACCCACTGG + Intronic
1061652424 9:132061682-132061704 CTGGCACCCAGGCCACCCACCGG + Intronic
1061877687 9:133553074-133553096 CGGCCACGCGGGCCTCCCACAGG - Intronic
1062002950 9:134226003-134226025 CGGCCTGGCAGCCCTCCCACAGG - Intergenic
1062303429 9:135888606-135888628 CAGATAGCCAGGCCGCCCACGGG - Intronic
1189577906 X:42375137-42375159 CCCCCTGCCAGGCGGCCCACAGG - Intergenic
1190259035 X:48786563-48786585 AGGCCAGCCAGGACACCCCCTGG + Exonic
1193804060 X:85972619-85972641 CGGCCAGCCCTGCCGGCCCCGGG - Intronic
1195156039 X:102125670-102125692 CCGCCCGCCAGCCCGCCCAGCGG + Exonic
1195684308 X:107571692-107571714 CAGCCAGCCAGGCAGCTCAGCGG + Intronic
1197000307 X:121431790-121431812 CGGCCAGCCCTGCCGGCCCCGGG - Intergenic
1197746011 X:129932495-129932517 CCGCCAGCCCGGCCGGCCTCCGG + Intergenic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic