ID: 1002175757

View in Genome Browser
Species Human (GRCh38)
Location 5:177400243-177400265
Sequence GCGCGCGCTCCTGGTGCTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002175757_1002175761 -1 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175757_1002175764 20 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175757 Original CRISPR GCGCGCGCTCCTGGTGCTAA TGG (reversed) Exonic