ID: 1002175757 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:177400243-177400265 |
Sequence | GCGCGCGCTCCTGGTGCTAA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 35 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 32} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002175757_1002175761 | -1 | Left | 1002175757 | 5:177400243-177400265 | CCATTAGCACCAGGAGCGCGCGC | 0: 1 1: 0 2: 1 3: 1 4: 32 |
||
Right | 1002175761 | 5:177400265-177400287 | CGGCGCACGGCCCACGCACACGG | 0: 1 1: 0 2: 0 3: 3 4: 45 |
||||
1002175757_1002175764 | 20 | Left | 1002175757 | 5:177400243-177400265 | CCATTAGCACCAGGAGCGCGCGC | 0: 1 1: 0 2: 1 3: 1 4: 32 |
||
Right | 1002175764 | 5:177400286-177400308 | GGCGCGCGCGTCCAGCCCCTTGG | 0: 1 1: 0 2: 1 3: 8 4: 99 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002175757 | Original CRISPR | GCGCGCGCTCCTGGTGCTAA TGG (reversed) | Exonic | ||