ID: 1002175757

View in Genome Browser
Species Human (GRCh38)
Location 5:177400243-177400265
Sequence GCGCGCGCTCCTGGTGCTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002175757_1002175761 -1 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175757_1002175764 20 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175757 Original CRISPR GCGCGCGCTCCTGGTGCTAA TGG (reversed) Exonic
904618873 1:31763891-31763913 GCCCCCGCTCCTGCTGCTGACGG - Exonic
915648953 1:157293696-157293718 GCCTGTGGTCCTGGTGCTAAGGG - Intergenic
924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG + Intronic
924722238 1:246635019-246635041 ACGCGCGCTGCTGGTGCAAGTGG + Intronic
924795640 1:247290461-247290483 ACGCGCGCTGCTGGTGCAAGCGG - Intergenic
1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG + Intergenic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG + Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG + Intergenic
1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG + Intronic
1135651267 16:24208791-24208813 GGGAGCGCTCCTGAAGCTAATGG + Intronic
1142742050 17:1937015-1937037 GCGCGCGCTCCCTGTGGGAATGG - Exonic
1146052774 17:29566658-29566680 GCCCGCGCTCCTGGTTCTCCGGG - Exonic
1152391447 17:80006166-80006188 GAGAGCGCTCCTGGTGCTCTGGG - Intronic
1158591354 18:58781475-58781497 AAACGCGCTCCTGGTGCTCAGGG - Intergenic
1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG + Exonic
947518664 2:230828224-230828246 GCGCGCGCTCCTGGAGGTACGGG + Intergenic
1181256777 22:21567908-21567930 GCGCAGGCTCAAGGTGCTAACGG + Intronic
1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG + Exonic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
985520958 5:373748-373770 GCGGGCGCTCCGGGTGCACACGG - Intronic
985863548 5:2493786-2493808 GCACCTGCTCCTGGTGCTATGGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG + Intergenic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG + Intergenic
1034414738 7:150958452-150958474 GCCCGCGCTGCTGGCGCTGACGG - Exonic
1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG + Intronic
1035582675 8:749780-749802 GAGCGCGCTCTTGGTGCTGGAGG + Intergenic
1043506717 8:80909995-80910017 ACGCACGCTGCTGGTGCAAATGG + Intergenic
1060153887 9:121305739-121305761 GCGCTGGCTCCTGGTGTGAATGG + Intronic
1060480002 9:124012259-124012281 CCTGGCGCTCCTGGCGCTAACGG - Exonic