ID: 1002175761

View in Genome Browser
Species Human (GRCh38)
Location 5:177400265-177400287
Sequence CGGCGCACGGCCCACGCACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002175752_1002175761 19 Left 1002175752 5:177400223-177400245 CCCATGTACGCCGCGTCGGCCCA 0: 1
1: 0
2: 0
3: 1
4: 6
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175754_1002175761 9 Left 1002175754 5:177400233-177400255 CCGCGTCGGCCCATTAGCACCAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175757_1002175761 -1 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175756_1002175761 0 Left 1002175756 5:177400242-177400264 CCCATTAGCACCAGGAGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175751_1002175761 20 Left 1002175751 5:177400222-177400244 CCCCATGTACGCCGCGTCGGCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175750_1002175761 21 Left 1002175750 5:177400221-177400243 CCCCCATGTACGCCGCGTCGGCC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175753_1002175761 18 Left 1002175753 5:177400224-177400246 CCATGTACGCCGCGTCGGCCCAT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45
1002175759_1002175761 -10 Left 1002175759 5:177400252-177400274 CCAGGAGCGCGCGCGGCGCACGG 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175761 Original CRISPR CGGCGCACGGCCCACGCACA CGG Exonic
903557011 1:24201388-24201410 CGGCGCCCGGCCCAAGCCCATGG - Intergenic
904702920 1:32368840-32368862 AGGCGCACGCCCCACACACCTGG + Intronic
905137089 1:35808242-35808264 CGGCGCCCGGCCCGGGGACAGGG - Exonic
905951343 1:41954076-41954098 CTGCGCAGGGCCCACCCGCAAGG + Intronic
906325516 1:44843148-44843170 CGGCCCACGGCCCACGGAGCGGG - Intergenic
920294285 1:204946472-204946494 CGGAGCATGCCCCACACACATGG + Intronic
923095084 1:230769033-230769055 CCGTGCATAGCCCACGCACATGG + Intronic
1085043883 11:73342635-73342657 CGGAGCACGGGACACACACAGGG - Intronic
1085465362 11:76719782-76719804 AGGCCCTCGGCCCAGGCACACGG + Intergenic
1104043386 12:125145068-125145090 AGGCCCACGGGCCACTCACAGGG - Intergenic
1104962461 12:132494761-132494783 TGGCACACGGGCCACGCAGAAGG + Intronic
1105411224 13:20173543-20173565 CAGCCCACCACCCACGCACATGG - Intergenic
1113546419 13:111154176-111154198 CGGCGCGCGGGCCACCCCCAGGG + Intronic
1122904121 14:104794211-104794233 CCGCGCACGCCTCAGGCACAGGG + Intronic
1127588250 15:60397935-60397957 CGGCGCACGGCCCAGGTAAGCGG - Exonic
1128451162 15:67806695-67806717 CAGCGCCCGGCACACCCACATGG - Exonic
1133142968 16:3761674-3761696 CGCAGCACTCCCCACGCACACGG + Intronic
1135577413 16:23596349-23596371 CGGCGCGCAGGCGACGCACACGG + Intronic
1136488017 16:30585571-30585593 CCGCGCCCGGCCCACGTACCCGG - Exonic
1142187295 16:88700709-88700731 CGGGGCACGGGCCAGGCACCAGG + Intronic
1146301242 17:31691486-31691508 CTGCCCACAGCCCAAGCACAGGG + Intergenic
1161698540 19:5783311-5783333 CGGCCCAGGGACCTCGCACAGGG + Exonic
1163314037 19:16530750-16530772 CGGCCCGGGGCCCACGCACCCGG + Exonic
937354596 2:121190207-121190229 CAGGGCCCGGCCCATGCACAAGG - Intergenic
937907722 2:127060522-127060544 GGGCGCAAGGCGCATGCACAGGG + Intronic
940316707 2:152335109-152335131 CGGCGCCCGGCCCCCGCCCCCGG - Intergenic
942505454 2:176637658-176637680 AGGCCCCCGGCCCACGCACGAGG - Intergenic
943669760 2:190648780-190648802 CGGAGGACGGCCCATTCACACGG - Intronic
948765026 2:240215190-240215212 GGGCGCCCGGCCCACACCCAGGG - Intergenic
1171265902 20:23772343-23772365 CTGCGCAGGGCACACCCACATGG + Intergenic
1173660121 20:44727356-44727378 CAGCCCAGGGCCCAGGCACAGGG - Exonic
1175404836 20:58719319-58719341 CAGCCCAGGCCCCACGCACATGG + Intergenic
952927203 3:38328873-38328895 CCGCCCAAGGCCCACCCACATGG - Intergenic
954717700 3:52534446-52534468 CAGCGCACGGCCCAGTCACCTGG - Intronic
961762640 3:129183296-129183318 AGGCGCACGACCCCAGCACATGG + Intronic
966411780 3:179652909-179652931 CCGCGCCCGGCCCACGCGCAGGG + Exonic
992877445 5:81070655-81070677 CTGCTCCCGGCTCACGCACAGGG - Intronic
1002175761 5:177400265-177400287 CGGCGCACGGCCCACGCACACGG + Exonic
1004872585 6:19922379-19922401 CTGCCCACAGCCCAGGCACATGG - Intergenic
1015410222 6:132885912-132885934 CGCCCCACAGCCCAGGCACAAGG + Intergenic
1032079164 7:128850053-128850075 CGGCGCCCGCCCCACACACTGGG + Exonic
1034219290 7:149431727-149431749 GGGGGCACGGCCCGCGCACCTGG + Exonic
1035753035 8:2008981-2009003 CGGCCCACGCCTCAAGCACACGG - Intergenic
1048157385 8:131971396-131971418 CCGCGCACGGCCTAATCACAAGG - Intronic
1048981287 8:139704321-139704343 CGGCGCAGGGCGCACGCGGAGGG + Intergenic
1060005758 9:119998101-119998123 CGGCTCGCGACCCACCCACAGGG + Intergenic
1062410373 9:136421116-136421138 CGGCGCAGGGCCCAGGCAGCTGG - Intronic
1062627246 9:137448873-137448895 CGACGCTGGCCCCACGCACACGG + Exonic
1185467224 X:362165-362187 CGGTGCACAGCCCACGCCCACGG + Intronic