ID: 1002175764

View in Genome Browser
Species Human (GRCh38)
Location 5:177400286-177400308
Sequence GGCGCGCGCGTCCAGCCCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002175754_1002175764 30 Left 1002175754 5:177400233-177400255 CCGCGTCGGCCCATTAGCACCAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
1002175756_1002175764 21 Left 1002175756 5:177400242-177400264 CCCATTAGCACCAGGAGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
1002175757_1002175764 20 Left 1002175757 5:177400243-177400265 CCATTAGCACCAGGAGCGCGCGC 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
1002175759_1002175764 11 Left 1002175759 5:177400252-177400274 CCAGGAGCGCGCGCGGCGCACGG 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175764 Original CRISPR GGCGCGCGCGTCCAGCCCCT TGG Exonic
900297832 1:1960814-1960836 GGCACGCACGTCCACCCTCTCGG - Intronic
900314429 1:2050043-2050065 GGCGCGCGCTGCCAGCCCGAGGG - Intergenic
905031217 1:34885625-34885647 GGCGGGGCCGTCCAGCCCGTCGG + Exonic
915309488 1:155000173-155000195 GGCGGGGGCGGCCGGCCCCTGGG + Intergenic
915322245 1:155062331-155062353 GGGGCGGGATTCCAGCCCCTGGG - Exonic
919748653 1:201023566-201023588 GGCGCGCGGGCCCAGCCCCGGGG - Exonic
919847145 1:201649327-201649349 GGCGCGCTCCTCCTGGCCCTTGG - Exonic
922804661 1:228379034-228379056 GCTCCGCGCGTTCAGCCCCTCGG + Intergenic
924944684 1:248838385-248838407 CGCCCGAGCGTCCGGCCCCTCGG - Exonic
1065589057 10:27247571-27247593 GGCTCGGGAGTCCAGCCCCAAGG - Intergenic
1065844969 10:29736441-29736463 GGCCCTGGCCTCCAGCCCCTGGG - Intronic
1067853169 10:49768449-49768471 GGCGCGGGCTCCCCGCCCCTTGG - Intergenic
1072503648 10:96043593-96043615 GGCGCGAGCGTCCAGGCGCTGGG + Exonic
1079163175 11:18012986-18013008 GGAGCGCGAGCCCAGCGCCTCGG - Exonic
1080283594 11:30585376-30585398 GGCGCGCGCGGGCGGCCCCGGGG + Intronic
1083729205 11:64643761-64643783 AGCGCGCGCGTCCAGGCGCGGGG - Intronic
1084891747 11:72240138-72240160 GGAGCGCGCGGCCAGCGCCAAGG - Exonic
1087432240 11:98069334-98069356 GGCGCGCGCCTCCAGCTGCTCGG - Intergenic
1103839487 12:123850826-123850848 GGCCCGGCCGGCCAGCCCCTTGG - Intronic
1104909894 12:132235645-132235667 GGCCCTGGCGGCCAGCCCCTCGG + Intronic
1105927195 13:25018666-25018688 GGCGGGCGCCTCCAGCCGCGCGG - Intergenic
1106602573 13:31200270-31200292 GGCGCGCGCGTCCCGCCGTCCGG + Intronic
1122634371 14:103123295-103123317 GCCGGGCGCGCCCAGCCCCTGGG + Intergenic
1123057581 14:105579417-105579439 TGGGCGTGGGTCCAGCCCCTTGG + Intergenic
1123080783 14:105692518-105692540 TGGGCGTGGGTCCAGCCCCTTGG - Intergenic
1123081858 14:105699350-105699372 TGGGCGTGGGTCCAGCCCCTTGG + Intergenic
1132527727 16:425921-425943 GGCGGGCGCGGGCATCCCCTCGG - Exonic
1139467123 16:67159952-67159974 CGCCCGCGCGTCCCGCCCCGCGG + Exonic
1141840016 16:86568199-86568221 GGCCCGCGCGTCCGGCCCCCGGG - Exonic
1142378864 16:89720892-89720914 CGGTCGCCCGTCCAGCCCCTCGG - Exonic
1146433660 17:32822631-32822653 GGCCCGCGCGGCCACCCCCCGGG - Intronic
1148170424 17:45514917-45514939 GGCTCGGGAGTCCAGCCCCAAGG - Intergenic
1148170900 17:45518910-45518932 GGCTCGGGAGTCCAGCCCCAAGG - Intergenic
1148278779 17:46330891-46330913 GGCTCACGAGTCCAGCCCCAAGG + Exonic
1148300991 17:46548753-46548775 GGCTCGGGAGTCCAGCCCCAAGG + Exonic
1148365121 17:47049642-47049664 GGCTCGGGAGTCCAGCCCCAAGG + Intergenic
1149953816 17:61022373-61022395 GGCGGGCGCCTCCAGCTACTCGG - Intronic
1150520289 17:65859887-65859909 GGCGGGCGCCTCCAGCTACTTGG + Intronic
1150781612 17:68127554-68127576 GGCTCGGGAGTCCAGCCCCAAGG - Intergenic
1151631182 17:75312002-75312024 GGTGCGCACGTCCAGCTACTCGG + Intergenic
1154161191 18:11981696-11981718 GGCGCTGGCGGCCGGCCCCTGGG + Exonic
1155199432 18:23503909-23503931 GGCTCGGGGGTCCAGCCCCGAGG - Intronic
1156338158 18:36187656-36187678 GGCGCGCGAGTTCAGCCGCCTGG + Exonic
1160157175 18:76442710-76442732 GGCGCAGGCGTCCAGGCCCTCGG + Exonic
1160791636 19:926155-926177 GGGGCGCGCGCCCCGCGCCTGGG - Intronic
1160967964 19:1754865-1754887 GGCGCGCAGGGCCAGACCCTGGG + Intronic
1160975174 19:1789512-1789534 GGCGCGCTCCTGCAGCACCTCGG + Exonic
1161210409 19:3062562-3062584 GGCGCGCGCGTCCCCCCCCTCGG - Intronic
1161388087 19:4007591-4007613 GGCGCGCGCGGCCACCGCCCGGG - Intergenic
1164189521 19:22901656-22901678 GGCCCGCGCCGCCACCCCCTGGG - Intergenic
1164492459 19:28727515-28727537 GGCCTGGGCGTCCGGCCCCTCGG - Intergenic
1165775614 19:38402963-38402985 GGCCCGCCCGCCCCGCCCCTCGG - Intergenic
1166777756 19:45323066-45323088 GGGGCGTGAGCCCAGCCCCTGGG - Intergenic
1168308983 19:55451436-55451458 GGCGCCCCCGTGCAGCCCCCAGG - Intergenic
927787308 2:25982596-25982618 GGCTCGCGCCTCCCGCCCCGCGG - Intronic
934763812 2:96869631-96869653 GGCGCGCCCCTCCGGCCCCGGGG + Intronic
934993256 2:98936106-98936128 AGCGCCCGCGTCCAGCTCTTCGG - Exonic
942268229 2:174248661-174248683 TGCCCGCGCGTCCCGCCCATTGG + Exonic
942276631 2:174328137-174328159 GGCTCGCGCGCCCAGAGCCTGGG - Intergenic
946691623 2:222312518-222312540 GGTCCGCGCGCCCTGCCCCTTGG + Intergenic
948237306 2:236400671-236400693 GGCGCGGGCGTGCCTCCCCTGGG + Intronic
1175215864 20:57391478-57391500 GGGGCGCCCGTCCAGCCGCCAGG - Exonic
1176078825 20:63261451-63261473 GTCGAGCGGCTCCAGCCCCTGGG - Intronic
1176233249 20:64042477-64042499 GGAACCCGCGTCCAGCCCCAGGG - Intronic
1176550602 21:8219244-8219266 GGCCCGCGCGGCCAACCCCCGGG - Intergenic
1176569532 21:8402285-8402307 GGCCCGCGCGGCCAACCCCCGGG - Intergenic
1176577444 21:8446514-8446536 GGCCCGCGCGGCCAACCCCCGGG - Intergenic
1179150722 21:38806149-38806171 GGCGCGCGGCTCCAGTCCCATGG + Intronic
1180006745 21:45026179-45026201 TGCGCAGGCCTCCAGCCCCTCGG + Intergenic
1181639058 22:24187390-24187412 AGCGGGCGCGTCCTGCCCCCAGG + Exonic
1184184821 22:42857406-42857428 CGCACGCGCGTGCAGCGCCTGGG - Intronic
1203255501 22_KI270733v1_random:135587-135609 GGCCCGCGCGGCCAACCCCCGGG - Intergenic
956678171 3:71754237-71754259 GGCGAGCGCGCGCAGCCCGTCGG - Exonic
957048834 3:75396332-75396354 GGCGGGCGCCTCCAGCCGCGCGG - Intergenic
966449090 3:180037164-180037186 GCCGCGCGCGCGCAGCCCCGAGG - Intergenic
968728071 4:2257388-2257410 GGCTCCCGCTGCCAGCCCCTAGG + Intronic
972396567 4:38663855-38663877 GCCGCGCACGCCCAGCCCCACGG + Intergenic
975689369 4:76949449-76949471 GGCGCGAGCTCCCAGCCCCGGGG - Intergenic
980866744 4:138561643-138561665 GCCGCGGGCGTTCAGCACCTTGG - Intergenic
984024120 4:174522528-174522550 CGCGCGCGCGTGCAGCCCGGCGG + Exonic
984146330 4:176065902-176065924 GGAGCACGCTTCCCGCCCCTCGG + Intronic
988264165 5:28928220-28928242 GGCGGGCGCCTCCAGCCGCGCGG - Intergenic
992561552 5:77957767-77957789 GGGGCGCGCGTCCCGGCGCTGGG - Intergenic
1002093544 5:176818029-176818051 GGAGCGGGCGTCCAGCCTCCGGG + Intronic
1002175764 5:177400286-177400308 GGCGCGCGCGTCCAGCCCCTTGG + Exonic
1002517859 5:179773014-179773036 GGCGCGCGCCCCCAGCTACTCGG - Intronic
1002715565 5:181224511-181224533 TGCCCCCGCCTCCAGCCCCTCGG + Exonic
1007623524 6:43229248-43229270 GGCGCGCGCGGTGAGGCCCTGGG - Exonic
1017021397 6:150143051-150143073 GCCGCGCGCGCCCAGCCGCCCGG - Intergenic
1018364115 6:163100407-163100429 GCGTCGCGCGGCCAGCCCCTGGG + Intronic
1018905044 6:168071101-168071123 GGTGCCGGTGTCCAGCCCCTTGG - Intronic
1020125535 7:5530843-5530865 GGCGCGCGCCCCCAGCCCCCGGG - Intronic
1022396003 7:29989071-29989093 GACGCGCGCGGGCCGCCCCTGGG - Intronic
1025112427 7:56229928-56229950 AGCGCGAGCGTCCAGTCGCTAGG - Intergenic
1026856590 7:73759094-73759116 GGAGCGCGCTGCCAGGCCCTGGG - Intergenic
1030820735 7:114087657-114087679 GGCGCGCGCGGCCACCCAGTGGG - Intronic
1034680688 7:152925478-152925500 CCCGCGCGCGCCCGGCCCCTCGG - Intergenic
1035023195 7:155810520-155810542 GGCGCGCGCGTCCACACTCGCGG + Intronic
1043388313 8:79768522-79768544 AGCGCGCGCCTCCAGCCGCCGGG - Intergenic
1049610715 8:143553538-143553560 GGCGAGCGCCTCCGTCCCCTGGG - Exonic
1049777464 8:144413313-144413335 GGCGCCCACGGCCAGCCCGTCGG + Exonic
1054076948 9:60545993-60546015 GGCGAGCGCCTCCAGCCGCGCGG + Intergenic
1060225674 9:121788875-121788897 GGCCCACGGGTCCAGCCCCCAGG + Intergenic
1061580125 9:131531229-131531251 GGCGCGCCCGCCCAGCGCCGAGG + Intronic
1062596322 9:137301436-137301458 GGCGCGTGCGTCCCGGCCCCAGG - Exonic
1203471897 Un_GL000220v1:118722-118744 GGCCCGCGCGGCCAACCCCCGGG - Intergenic
1186107747 X:6226113-6226135 GACGCGCGCGCCCAGCACCCGGG + Intronic
1195625183 X:106999832-106999854 CGCGCGCGCGTCCGCCCCCTCGG + Intronic
1197872537 X:131073291-131073313 GCTGCGCGGGTCCTGCCCCTGGG - Intronic