ID: 1002175785

View in Genome Browser
Species Human (GRCh38)
Location 5:177400378-177400400
Sequence CCTGCAGGCGGGCCTGAGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002175785_1002175797 21 Left 1002175785 5:177400378-177400400 CCACGCTCAGGCCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 250
Right 1002175797 5:177400422-177400444 GTGAGCACGCCCACCTCCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 113
1002175785_1002175791 -6 Left 1002175785 5:177400378-177400400 CCACGCTCAGGCCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 250
Right 1002175791 5:177400395-177400417 TGCAGGAAGGTGTGCCTGTCCGG 0: 1
1: 0
2: 1
3: 19
4: 210
1002175785_1002175798 29 Left 1002175785 5:177400378-177400400 CCACGCTCAGGCCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 250
Right 1002175798 5:177400430-177400452 GCCCACCTCCTGCGGCGAGATGG 0: 1
1: 0
2: 0
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002175785 Original CRISPR CCTGCAGGCGGGCCTGAGCG TGG (reversed) Exonic