ID: 1002177480

View in Genome Browser
Species Human (GRCh38)
Location 5:177409432-177409454
Sequence GAACAATCCTGGGACAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002177468_1002177480 30 Left 1002177468 5:177409379-177409401 CCCACAGGTCATGAGCAGAGGCC 0: 1
1: 0
2: 3
3: 19
4: 172
Right 1002177480 5:177409432-177409454 GAACAATCCTGGGACAATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 110
1002177469_1002177480 29 Left 1002177469 5:177409380-177409402 CCACAGGTCATGAGCAGAGGCCA 0: 1
1: 0
2: 1
3: 30
4: 245
Right 1002177480 5:177409432-177409454 GAACAATCCTGGGACAATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 110
1002177472_1002177480 9 Left 1002177472 5:177409400-177409422 CCATGGCTCATGGCTGTGATAGC 0: 1
1: 0
2: 1
3: 111
4: 2633
Right 1002177480 5:177409432-177409454 GAACAATCCTGGGACAATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002177480 Original CRISPR GAACAATCCTGGGACAATCC TGG Intronic
901115190 1:6838079-6838101 GAACAGTCCCTGGACACTCCAGG - Intronic
902638274 1:17749571-17749593 GAACAACCCTGGGACAATGTGGG - Intergenic
910301330 1:85710071-85710093 GACCAATCCTGGGATGATGCAGG - Intergenic
915185175 1:154099047-154099069 GAACAAAGTTGGGCCAATCCTGG - Intronic
918058294 1:181041612-181041634 GAACATGCCTGGCACATTCCAGG - Intronic
921697557 1:218229751-218229773 CAAAATTCCTGGGACAGTCCAGG + Intergenic
1063102529 10:2962965-2962987 CAACAGTCCAGGGACCATCCCGG + Intergenic
1069861919 10:71476866-71476888 GAACATTCCTGAGAGAATCTGGG + Intronic
1070329233 10:75405927-75405949 GCACACTCCTGGGGCAACCCGGG - Intergenic
1071451341 10:85793840-85793862 GAGCATTCCTGGGATAGTCCTGG + Intronic
1071853017 10:89594483-89594505 GGCCACTCCTGGCACAATCCTGG - Intronic
1075603132 10:123785458-123785480 GGACAGTCCTGGGAAAATCTGGG - Intronic
1076000149 10:126906853-126906875 GGACAGTCCTGGGACAGCCCTGG + Intronic
1078337615 11:10476399-10476421 GAACATTCCTAGGACAAGCCTGG + Intronic
1079217023 11:18522880-18522902 AAACAAACCTGGAACAATCTGGG - Intronic
1079294637 11:19222020-19222042 GAACAATAATAGGACAAACCTGG + Intergenic
1080843584 11:36006716-36006738 GAACAATCCCATGACAATGCAGG + Intronic
1082753177 11:57044736-57044758 CAATAGTCCTGGGACAATTCGGG - Intergenic
1084269240 11:68020280-68020302 GCACAATCTTGGCACAATCTTGG + Intronic
1088665485 11:112089615-112089637 GAACATGCCAGGGACATTCCAGG + Intronic
1089209942 11:116792889-116792911 AAACAATCCTGGAACAAGCAAGG + Intergenic
1092161359 12:6317143-6317165 GAGCATTCCTGGGAGGATCCTGG + Intronic
1093751599 12:22806366-22806388 GAAACATCCTGCGACAAACCTGG - Intergenic
1097442618 12:59629342-59629364 GAACAGTACTTGGAGAATCCAGG + Intronic
1099999751 12:89819133-89819155 GAACAATTATGGGACATTTCAGG - Intergenic
1102450805 12:113040768-113040790 GAACTTGCCTAGGACAATCCTGG - Intergenic
1105603559 13:21908747-21908769 TAACAATCCCAGGACAAACCTGG - Intergenic
1107789776 13:43990068-43990090 CAACCATCCTGGGACAGTCCAGG + Intergenic
1108268601 13:48736382-48736404 GAACAACCTTGGGCCAATCTGGG - Intergenic
1113355512 13:109576258-109576280 GAACAATTCTGGGCCATTGCTGG - Intergenic
1113498022 13:110748790-110748812 GAAGAATTATGGGACAAACCTGG - Intergenic
1114910371 14:27187224-27187246 GAACAATTCTTCAACAATCCTGG - Intergenic
1116473748 14:45316043-45316065 GAAAAATCCAGGAAAAATCCAGG - Intergenic
1120120609 14:80675897-80675919 GAACAATTCAGTAACAATCCTGG - Intronic
1121488807 14:94343263-94343285 GAACAGTTCTGCTACAATCCAGG + Intergenic
1123805621 15:23869461-23869483 TTACCATCCTGGGACAAACCGGG - Intergenic
1127291784 15:57577907-57577929 CTACAACCCTGGGACAATACTGG + Intergenic
1131508411 15:93035627-93035649 GAACAATCCAGAGACAAACACGG + Intronic
1131783121 15:95881683-95881705 CAACAGGCCTAGGACAATCCCGG + Intergenic
1132116158 15:99137975-99137997 GAAAAAGCCTAGGACATTCCTGG - Exonic
1132129012 15:99257392-99257414 GAACAAACATGGGAAAATCTAGG - Intronic
1132225180 15:100134849-100134871 GAACAATCATGGGAACATGCAGG - Intronic
1135995102 16:27241674-27241696 GAACAATGCTGGGAAGAGCCGGG + Intronic
1139228099 16:65252684-65252706 GAACAATCCTGGAAAGCTCCAGG - Intergenic
1139304251 16:65969624-65969646 TAACACCCCTGGGACAATCTTGG - Intergenic
1141135238 16:81460477-81460499 GCAAAAACCTGGGACAGTCCTGG - Intronic
1147237933 17:39071497-39071519 AAACTATCCTGGGGCACTCCAGG + Intronic
1148073523 17:44922268-44922290 GGACATTCCTGGGAGAATCTGGG + Intergenic
1148994498 17:51697835-51697857 GAAGTATCCTGGGGAAATCCAGG - Intronic
1151450022 17:74192995-74193017 AGACTATCCTGGGACAATCCTGG - Intergenic
1156289631 18:35734966-35734988 GGATAATCCTGGGATAATCCAGG - Intergenic
1159584063 18:70266249-70266271 GAAACATCCTGGGACAACCTGGG + Intergenic
1160048412 18:75408680-75408702 GAACTATCCTGGGAGCATCACGG - Intronic
1166009164 19:39928288-39928310 GAAGCCTCCTGGGTCAATCCTGG + Exonic
1166341166 19:42138101-42138123 GAACACTTTTGTGACAATCCTGG + Intronic
926424919 2:12731819-12731841 GAACAAGACTGGGAAAATTCTGG + Intronic
935424032 2:102900655-102900677 GCACAGTCCTGGGAGGATCCTGG + Intergenic
936537501 2:113323599-113323621 GAACTATCCTGGCACAGTGCTGG - Intergenic
939032348 2:137092142-137092164 GCTCGATCCTGGGCCAATCCTGG + Intronic
939462851 2:142519092-142519114 GCACAGTACTGGGACAATTCAGG - Intergenic
945201878 2:207289972-207289994 CAATAATCCTGGGAGGATCCTGG - Intergenic
1168842666 20:919704-919726 GAACGAAGCTGGGACAATACAGG - Intergenic
1170272437 20:14542736-14542758 GAATAGTCATGGGAGAATCCAGG + Intronic
1170801785 20:19596353-19596375 GAAAAATCATGGAACACTCCTGG + Intronic
1172441850 20:34971558-34971580 GTACAAACCTGGGACAAGCAGGG + Intergenic
1172859233 20:38034120-38034142 GGACAATCCGGGGACCGTCCAGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174884425 20:54316488-54316510 GAACCAGCTTGGGACCATCCTGG + Intergenic
1175341151 20:58229736-58229758 GAACAATCTTGGAAAAATCTCGG + Intergenic
1178263515 21:31121280-31121302 AAACAACCCTGGGACAGCCCTGG - Intronic
1179476220 21:41647790-41647812 GCACAATGTTGGGACAGTCCAGG - Intergenic
1179992395 21:44954799-44954821 GAACAAAACTGGAACAAACCAGG - Intronic
1180489487 22:15829528-15829550 GAAAATTCCTGGAACAATTCAGG + Intergenic
1182050594 22:27310092-27310114 GAGCAACCCTGGGTGAATCCTGG - Intergenic
1183282757 22:36941254-36941276 GGGCACTCCTGGGAAAATCCAGG + Intergenic
1183336816 22:37253347-37253369 GAACAATCCTGGAACCATGTGGG + Intergenic
1183769163 22:39908590-39908612 GAACAATTCTGGGACATTAAAGG - Intronic
1183782262 22:40006501-40006523 GGACAATCCTGGGACAGCCCTGG + Intronic
950610226 3:14122068-14122090 GAACCATCCTGGGCAAAGCCTGG + Exonic
951051391 3:18097811-18097833 GGACACACCTGGGATAATCCAGG + Intronic
955056137 3:55457629-55457651 GACCACACCTGGGAGAATCCTGG - Intergenic
955773029 3:62405226-62405248 GAGCAATCCTGGCAAACTCCTGG + Intronic
973865975 4:55113365-55113387 GTACAATCCTTGGTCACTCCGGG + Exonic
976982432 4:91247385-91247407 GGATGATCCTGGAACAATCCAGG + Intronic
982089392 4:151867368-151867390 CAACACTCCTGGGACATCCCTGG - Intergenic
988872395 5:35405549-35405571 CAACATTCCTGGGAAAATGCAGG - Intergenic
1002177480 5:177409432-177409454 GAACAATCCTGGGACAATCCTGG + Intronic
1004044042 6:12009502-12009524 CAAAAATCCTGGGACAATGCAGG - Intronic
1006082377 6:31574962-31574984 GGACAAGCCTGGGACAGCCCCGG - Intergenic
1006145096 6:31954251-31954273 GAGAAGTCCTGGGAGAATCCTGG - Intronic
1006213331 6:32415879-32415901 GAACCACCCTGGGAGAATGCGGG + Intergenic
1008035847 6:46744491-46744513 GGAAAATCCTGGGGAAATCCTGG + Intergenic
1008274931 6:49531997-49532019 GAACAAAATTGGGACAGTCCTGG - Intergenic
1011074989 6:83429944-83429966 GAACAATCCCGAGACAAACCTGG + Intronic
1015108546 6:129566129-129566151 GTTCACTCTTGGGACAATCCTGG - Intergenic
1015114189 6:129628845-129628867 GAACAATATTGTGACAATCGGGG + Intronic
1015498475 6:133906129-133906151 GAGCAATCCTGGGACAATTCTGG - Intergenic
1022581983 7:31564627-31564649 GCAGAAACCTGGGAAAATCCAGG + Intronic
1023062034 7:36337003-36337025 GAAGAATCCTTGCACAACCCAGG + Intronic
1023526997 7:41115158-41115180 GAGCAATCCTGGGACAGAGCTGG + Intergenic
1025525804 7:61808545-61808567 GGACATTCCTGGGATATTCCTGG + Intergenic
1025549195 7:62221278-62221300 GGACATTCCTGGGATATTCCTGG + Intergenic
1032440106 7:131936123-131936145 GAAAAGCCCTGGGCCAATCCAGG - Intergenic
1038940328 8:32297218-32297240 GTAAAATCCTGGGAAAATCAAGG + Intronic
1039408041 8:37329423-37329445 TTACAAGCCTGGGACAAGCCTGG - Intergenic
1040301712 8:46191427-46191449 CAGCACTCCTGGGAAAATCCTGG - Intergenic
1040314843 8:46255464-46255486 CAGCACTCCTGGGACAGTCCTGG - Intergenic
1056311441 9:85345703-85345725 GAAGAATCCTGGAACAACCCCGG - Intergenic
1058162443 9:101584145-101584167 GCTCAATCCTGGGACTAGCCGGG - Intronic
1059290893 9:113222462-113222484 AAACAATCCTGGGGTAGTCCTGG + Intronic
1059719029 9:116941263-116941285 GAATTATCCTGGGATAATCTGGG + Intronic
1061735161 9:132650269-132650291 TAACACTCCAGGCACAATCCAGG + Exonic
1188484509 X:30668547-30668569 GAATAAGCCTGGGACATTTCCGG + Intronic
1188494243 X:30766633-30766655 GAACAAACCTGGGACAAGTCTGG + Intergenic
1188517047 X:30998993-30999015 GAACAATCTTGGTATATTCCAGG - Intergenic
1192833069 X:74770664-74770686 GAACAAACATGGGAAAATCTGGG - Intronic
1193540013 X:82759710-82759732 GACCAATCCTTGGCCAAGCCAGG + Intergenic
1194223972 X:91231658-91231680 GAACAATCCTGCAACAAACATGG - Intergenic
1199916473 X:152347041-152347063 GAACAGTCCTGTGACAAACATGG - Intronic
1200560438 Y:4695039-4695061 GAACAATCCTGCAACAAACATGG - Intergenic
1200657231 Y:5917672-5917694 AAACAATGCTGGAACAATGCTGG + Intergenic
1201260504 Y:12154438-12154460 CAATATTCCTGGGACAATACAGG - Intergenic