ID: 1002180649

View in Genome Browser
Species Human (GRCh38)
Location 5:177429399-177429421
Sequence AACTGAGGGTGGGAGGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002180639_1002180649 10 Left 1002180639 5:177429366-177429388 CCTTGATGTGGCTGGGAGGGGGG 0: 1
1: 0
2: 3
3: 27
4: 411
Right 1002180649 5:177429399-177429421 AACTGAGGGTGGGAGGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002180649 Original CRISPR AACTGAGGGTGGGAGGCTGG CGG Intronic
No off target data available for this crispr