ID: 1002181360

View in Genome Browser
Species Human (GRCh38)
Location 5:177432705-177432727
Sequence GGGTCCTGACCTCATCCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002181351_1002181360 10 Left 1002181351 5:177432672-177432694 CCCCTGCACTGACCTGTCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 302
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237
1002181355_1002181360 -2 Left 1002181355 5:177432684-177432706 CCTGTCTGGGGCTTGTTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237
1002181354_1002181360 8 Left 1002181354 5:177432674-177432696 CCTGCACTGACCTGTCTGGGGCT 0: 1
1: 0
2: 1
3: 38
4: 245
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237
1002181348_1002181360 19 Left 1002181348 5:177432663-177432685 CCAAGGGAGCCCCTGCACTGACC 0: 1
1: 0
2: 3
3: 35
4: 269
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237
1002181353_1002181360 9 Left 1002181353 5:177432673-177432695 CCCTGCACTGACCTGTCTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237
1002181347_1002181360 23 Left 1002181347 5:177432659-177432681 CCATCCAAGGGAGCCCCTGCACT 0: 1
1: 1
2: 1
3: 17
4: 198
Right 1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG 0: 1
1: 1
2: 1
3: 16
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002181360 Original CRISPR GGGTCCTGACCTCATCCCTG AGG Exonic
900092394 1:926098-926120 GAGTCCTAACCTCACCCCTGCGG + Intronic
900117556 1:1035004-1035026 GGGTCCTGCCTGCACCCCTGTGG + Intronic
900418547 1:2545985-2546007 GGCCCCTGTCCTCACCCCTGAGG + Intergenic
900479321 1:2890414-2890436 GGGTCCTGGCTTCCTGCCTGTGG + Intergenic
900677498 1:3897042-3897064 GGGTACTGTCCCCAACCCTGGGG - Intronic
900685764 1:3946639-3946661 TGGTCCTGAGCTCAACCCTGAGG - Intergenic
900912626 1:5612388-5612410 GTGTCCTGACCACTGCCCTGGGG - Intergenic
901302689 1:8211118-8211140 TTGTCCTGACCACAACCCTGAGG + Intergenic
901653603 1:10756607-10756629 GGGTCCTGACACCATCTGTGAGG - Intronic
902329846 1:15725924-15725946 GGGTGCTGATCCCATTCCTGAGG + Intronic
902376021 1:16030257-16030279 GGCTCCTGTCCCCAGCCCTGCGG + Intronic
902380960 1:16052002-16052024 GGCTCCTGTCCCCAGCCCTGCGG + Intronic
903020480 1:20390224-20390246 GGGTCCTCAGCGCATCCTTGGGG + Intergenic
903318955 1:22530212-22530234 GGGTGCTGAACTCACCCTTGGGG - Exonic
904013790 1:27405373-27405395 GGGACCTGCCCCCATTCCTGTGG - Exonic
907809275 1:57852200-57852222 GTGTCCTGCCCTGTTCCCTGGGG + Intronic
907822857 1:57988124-57988146 AGGTCCTGACCACATACATGCGG + Intronic
911088308 1:93998034-93998056 GCTTCCTGACCTGAACCCTGTGG - Exonic
911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG + Intergenic
912871099 1:113307453-113307475 GAGTCAGGACCTGATCCCTGAGG + Intergenic
913110587 1:115654060-115654082 GGGGCCTGCTCTCATGCCTGTGG - Intronic
915292562 1:154896479-154896501 GGGTCCTCATCTGCTCCCTGGGG - Intergenic
915464146 1:156086448-156086470 GGCTTCTGGCCTCATGCCTGGGG + Intronic
915980753 1:160418583-160418605 GGGACCTGAGCTGATCCTTGGGG - Intronic
917521493 1:175751568-175751590 GGGTCCTAATCCCATCCATGAGG - Intergenic
918039715 1:180906659-180906681 GGGTCCTGGTCCCATCCCAGTGG + Intergenic
918354102 1:183689736-183689758 GATTCCTGGCCTCATCCTTGTGG + Intronic
918942956 1:191026121-191026143 AGGTCCTGAGCTCTGCCCTGCGG + Intergenic
919824264 1:201492639-201492661 GGGCTCTGACCTCTCCCCTGGGG - Intronic
921370556 1:214418509-214418531 AGATCCTGCCTTCATCCCTGTGG - Intronic
923050493 1:230388267-230388289 GGGTCCTGCTCTCAGCCTTGTGG - Intronic
923141239 1:231162739-231162761 GGGTCCTCACCTCCTGCCCGAGG - Intronic
924769246 1:247064480-247064502 GGGACCTGACCTCACCCAGGAGG + Intronic
1063197875 10:3759952-3759974 TGGTCCTGACTCCATCCCTTCGG - Intergenic
1064481242 10:15742939-15742961 GGGACCTCACCACATCCCAGGGG - Intergenic
1065804774 10:29384303-29384325 GTGTCCTGCCCTCATCCCCAGGG + Intergenic
1067992041 10:51225272-51225294 GGGCCCTCATCTCATCCATGAGG + Intronic
1068945475 10:62724745-62724767 AGGTACTGACTTCATCCCAGAGG - Intergenic
1070130616 10:73653208-73653230 TGGTCCTCATCTCATCCCTATGG - Exonic
1070774237 10:79100515-79100537 GGGGCCTGATCACATCCCAGAGG + Intronic
1071778927 10:88820534-88820556 GGGTCCTAGCCCCATCCCTCAGG - Intronic
1072664183 10:97381850-97381872 GGGGCCTGGCCTGAGCCCTGGGG + Intronic
1072841453 10:98778517-98778539 GCCTCCTGACCACTTCCCTGTGG - Intronic
1074261661 10:111859914-111859936 GGGTCTTGACCATATCCCTGAGG + Intergenic
1074469528 10:113714706-113714728 GGGTCCTGACCACAGCCCACAGG - Intronic
1074527977 10:114278104-114278126 GGGTCCTGACCTCTTGCCTCAGG - Intronic
1075115844 10:119626688-119626710 CTGTCCTGACCACAGCCCTGGGG - Intergenic
1075655101 10:124156121-124156143 TGGTGCTGCCCTCATGCCTGGGG + Intergenic
1076694999 10:132243100-132243122 GCGACCTCCCCTCATCCCTGGGG + Intronic
1076855922 10:133115619-133115641 GGGTCCTGGCCTCCCTCCTGGGG - Intronic
1078253381 11:9637023-9637045 GGGTCATGTGCCCATCCCTGAGG + Intergenic
1080335326 11:31188921-31188943 GGGTACTGACCCCATTCATGAGG - Intronic
1081754202 11:45532982-45533004 TGGTCCTCACCTCTTCCCAGGGG + Intergenic
1081870452 11:46380696-46380718 GGTTCCTGACCTCTGCCCGGCGG + Intergenic
1082278684 11:50247109-50247131 GTGTCCTGACCCAAGCCCTGTGG - Intergenic
1083749625 11:64754049-64754071 GGATGCTGACCTCAGCCCAGTGG + Intronic
1084203459 11:67577288-67577310 GGGGCCTGAGCTCAGCCCAGGGG + Intergenic
1084220349 11:67674145-67674167 GGGGTCTGTCCCCATCCCTGGGG + Intronic
1085729234 11:78982390-78982412 GGACTCTGGCCTCATCCCTGAGG - Intronic
1085771586 11:79330669-79330691 GGATCCTGATGTCATGCCTGTGG - Intronic
1085782155 11:79419364-79419386 GGGAGCTGACCTCTTACCTGTGG - Intronic
1088045369 11:105443977-105443999 GGGCACTGGCCTCATGCCTGGGG - Intergenic
1089593565 11:119560469-119560491 GGGTCTTGCCCTGAGCCCTGGGG + Intergenic
1091836843 12:3592155-3592177 GGGTCCCAGCCTCATCCCTTTGG + Intronic
1092144231 12:6203550-6203572 CTGGCCTGATCTCATCCCTGTGG + Intronic
1092961659 12:13602003-13602025 GGGTCCAGAACAGATCCCTGGGG - Intronic
1094642841 12:32293067-32293089 GGCTCCTCTCCTTATCCCTGTGG + Intronic
1096521850 12:52188948-52188970 TGGTCCTGAGCTCGTCCCAGTGG - Intronic
1098188194 12:67920973-67920995 GGGTCCTGCCTTCCTCACTGAGG + Intergenic
1098392497 12:69984381-69984403 GGGTGATTTCCTCATCCCTGAGG - Intergenic
1100819805 12:98420477-98420499 GGGTCCTGGGCTCTCCCCTGGGG - Intergenic
1101908029 12:108842325-108842347 GAGTCCTGCCCTAACCCCTGTGG - Intronic
1103917796 12:124384911-124384933 GGGTGCTGATCTCATAACTGTGG + Intronic
1105214778 13:18277786-18277808 GGCTCCTGGTCCCATCCCTGGGG + Intergenic
1105541270 13:21319494-21319516 GGTTCCTGACCTCATCCCTGAGG + Intergenic
1107177376 13:37414853-37414875 GGGGCATGACCTCATCCAGGTGG - Intergenic
1110170727 13:72497310-72497332 GAGCTCTGTCCTCATCCCTGTGG + Intergenic
1110800161 13:79684905-79684927 GGGCCCAGACCTGCTCCCTGGGG + Intergenic
1113431754 13:110256502-110256524 GGGCACTGACATCCTCCCTGTGG - Intronic
1113925146 13:113937603-113937625 AGGTCCTGACAACATGCCTGAGG + Intergenic
1119507486 14:75185461-75185483 GGGTCCTTCCCTATTCCCTGGGG + Intergenic
1122086885 14:99313892-99313914 GGGTCTTGAGCTCATCTCTATGG - Intergenic
1122818109 14:104323991-104324013 GGGTCCAGAGAGCATCCCTGAGG + Intergenic
1123039410 14:105484285-105484307 GGGCACTGACCTCGTCCATGGGG - Intergenic
1123726299 15:23105752-23105774 GGGTACTAACCTCATTCATGAGG + Intergenic
1124067212 15:26355280-26355302 GGGCTCTGACCTCAACCCTCAGG - Intergenic
1124599002 15:31115995-31116017 GGGCACTAATCTCATCCCTGAGG + Intronic
1127787824 15:62371727-62371749 GGGTCCTGCCCTGTGCCCTGGGG - Intergenic
1129911367 15:79229873-79229895 GGGTCCTAATCTCATTCATGAGG - Intergenic
1131177612 15:90219896-90219918 GTGACCTGTCCTCAGCCCTGAGG + Intronic
1131266479 15:90918463-90918485 GGGTCTGGACCTCATCCTGGAGG - Intronic
1131851519 15:96548864-96548886 AGGTCCTGAACTCATACCTGAGG - Intergenic
1134445893 16:14331229-14331251 GTGGCCTGGCCTCACCCCTGTGG - Intergenic
1136276086 16:29180243-29180265 AGGGCCTGACCTCACCCTTGAGG - Intergenic
1136276680 16:29182929-29182951 AGGGCCTGACCTCACCCTTGAGG - Intergenic
1137264823 16:46860038-46860060 GGGTCCCGCCCACATCACTGAGG - Intergenic
1137374797 16:47943328-47943350 GGGACCTGACTCCGTCCCTGAGG - Intergenic
1140415278 16:74770018-74770040 GGGTCCAGGCCTTCTCCCTGGGG + Intronic
1141569480 16:84925553-84925575 GGGTCCCGCCCCCATCCCAGGGG + Intergenic
1141606394 16:85156310-85156332 GCCTCCTGACCTGATCGCTGGGG + Intergenic
1141628061 16:85271894-85271916 GTGCCCTGACCCCAGCCCTGGGG - Intergenic
1141698734 16:85632797-85632819 GGGTCCCGGCTTCCTCCCTGTGG - Intronic
1142063933 16:88049500-88049522 GGGTCCTGCCCTAGACCCTGGGG - Intronic
1142080465 16:88146305-88146327 AGGGCCTGACCTCACCCTTGAGG - Intergenic
1142081062 16:88148990-88149012 AGGGCCTGACCTCACCCTTGAGG - Intergenic
1143269844 17:5667427-5667449 GAGTCCTTACCACAGCCCTGTGG - Intergenic
1143614725 17:8042903-8042925 GGATCCTGACCTCTTTCCTGGGG + Intronic
1143697597 17:8631370-8631392 GAGTCCTGACGTCACCCCCGGGG + Intergenic
1144205976 17:12979839-12979861 GGGTTCTGCCCCCATCTCTGTGG - Intronic
1145004389 17:19329164-19329186 GGGTCCTGTCCTCACCCCTGGGG + Intronic
1146255689 17:31390756-31390778 GGGTCCTGACCTAGAGCCTGCGG + Intergenic
1146285209 17:31569927-31569949 GGGTCCTGACTTCATCCCCTGGG - Intergenic
1146285600 17:31572363-31572385 GGGTCGTGACTTCATCCCTTTGG + Intronic
1146953544 17:36922716-36922738 GGGTCATGACCCCATACCTTAGG + Intergenic
1148441039 17:47711695-47711717 GGCTCCCCACCTCAGCCCTGGGG - Exonic
1148804422 17:50257197-50257219 GGGTCCTGCCTACCTCCCTGTGG + Intergenic
1149268281 17:54951413-54951435 GGGTCCTGCCCTATACCCTGGGG - Intronic
1149499130 17:57138239-57138261 GGCTCCTGACCAGCTCCCTGAGG - Intergenic
1150283876 17:63944868-63944890 GGGTCCTGCCCTCAGGGCTGTGG - Intronic
1150431546 17:65122458-65122480 GGGTCCTAACGTCCTCCCTATGG - Intergenic
1150623472 17:66825258-66825280 AGCTCCTGAACTCATCCCTCTGG + Intergenic
1152601345 17:81263768-81263790 GGGTCCATGCCTCATCCATGAGG + Intronic
1152678507 17:81653692-81653714 GAGTCCTCACCACCTCCCTGTGG + Intronic
1152759783 17:82101784-82101806 GGCTGCTGTCTTCATCCCTGGGG + Exonic
1152798104 17:82317754-82317776 AGGCCTTGACCTCCTCCCTGTGG - Intergenic
1153536479 18:6107445-6107467 AGGTCCTGTCCCCATCCCTCAGG - Intronic
1157515272 18:48306719-48306741 GGGCTCTGACCCCATACCTGGGG - Intronic
1157555970 18:48613079-48613101 GGTCACTGAACTCATCCCTGAGG + Intronic
1160951231 19:1668649-1668671 GGGTCCTGGGCTCCTCCCGGTGG - Intergenic
1161776294 19:6263977-6263999 GGGGCCTGAGCTTCTCCCTGGGG + Intronic
1161799993 19:6412232-6412254 GGGCCCAGACCTGACCCCTGCGG + Intergenic
1163403932 19:17110912-17110934 GGGTCCTGAGCTCCTCCTTAGGG + Intronic
1163627178 19:18396995-18397017 TAGCCCTGACCTCAGCCCTGTGG + Exonic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
926303342 2:11619067-11619089 GAGTCCTGCCCTCCTCCCTCCGG - Intronic
927786986 2:25981275-25981297 GGGAGCTGACCTCATTCATGTGG + Exonic
931819265 2:65935161-65935183 GTGTCCTGGGCTCTTCCCTGTGG - Intergenic
932001149 2:67886274-67886296 GGGTCCTAATCTCATTCATGAGG + Intergenic
932484906 2:72078898-72078920 GGCTGCTGACCTCAAACCTGTGG + Intergenic
932494024 2:72137778-72137800 GGGTCCACACCTGACCCCTGGGG + Intronic
932729221 2:74206288-74206310 TGTTCCTGACCTCATCACTGAGG - Intronic
934299543 2:91768951-91768973 GGCTCCTGGTCCCATCCCTGGGG - Intergenic
934544736 2:95205610-95205632 GGGCCTAGACCTTATCCCTGGGG + Intergenic
935946737 2:108293669-108293691 TGGCCCTGACCTCAGACCTGGGG + Exonic
940517471 2:154698851-154698873 GGGTCCTGGCCTGGCCCCTGGGG - Exonic
945672528 2:212819531-212819553 GGGCCCCAATCTCATCCCTGAGG + Intergenic
947535101 2:230935103-230935125 GGGTCCTGCCACCATCTCTGAGG - Intronic
947856558 2:233328265-233328287 GGGTCCTGGTCCCTTCCCTGTGG - Intronic
948522297 2:238547685-238547707 GGGGTCTTAACTCATCCCTGAGG - Intergenic
948698694 2:239747370-239747392 GCTTGCTGCCCTCATCCCTGTGG + Intergenic
948899333 2:240948222-240948244 GGGTTCTGACCTGAGCCCAGAGG + Intronic
1171433746 20:25103927-25103949 GGGCTCTGGCCTCATCACTGGGG - Intergenic
1172354574 20:34270536-34270558 GCATCCTGGCCTCACCCCTGGGG - Intergenic
1174171724 20:48621782-48621804 GGGCCCTGCCCTCATCCTGGAGG + Intergenic
1175242786 20:57562089-57562111 CGATCCTGGCCACATCCCTGGGG - Exonic
1175301025 20:57942806-57942828 GGGTGCTAACCAGATCCCTGTGG + Intergenic
1175942143 20:62542314-62542336 GGGTCCTCCCCACATCCCGGGGG + Intergenic
1179357833 21:40677723-40677745 GGGCCCTAACCTCATTCATGAGG - Intronic
1179842968 21:44089253-44089275 GGGTATTCACCTCTTCCCTGTGG + Intronic
1179892833 21:44345567-44345589 GGCTCCACACCACATCCCTGAGG + Intergenic
1181149854 22:20875466-20875488 GGGTCCCCACTGCATCCCTGTGG - Intronic
1181282124 22:21727756-21727778 GGGTCGTCGCCCCATCCCTGGGG + Intronic
1181694343 22:24585448-24585470 GGGTCCTGGGTCCATCCCTGTGG - Intronic
1181697904 22:24603051-24603073 GGCTCCTGGTCCCATCCCTGAGG - Intronic
1181844932 22:25699385-25699407 GGCGCCTGTCCTCAACCCTGGGG + Intronic
1183856258 22:40636912-40636934 GGGAGATGACCTCATCTCTGAGG + Intergenic
1184691140 22:46117843-46117865 GGGTCCTGCTCCCAGCCCTGGGG - Intergenic
1184811897 22:46841225-46841247 GGGCCCTAACCTCATCCATGAGG - Intronic
1184874480 22:47264809-47264831 GGATCCCCACCTCATCCATGGGG - Intergenic
952002129 3:28798172-28798194 GGGCCCTGAACTCTTCCCTTAGG - Intergenic
952865440 3:37852351-37852373 GTTTCCTGAGGTCATCCCTGAGG + Intergenic
953006942 3:38987612-38987634 GGGGTCTAACTTCATCCCTGAGG + Intergenic
953916039 3:46921899-46921921 AGGAGCTGACCTCATCCATGGGG + Exonic
954300918 3:49700357-49700379 GGCTCCTGACCTCAGGCCTCAGG + Intronic
954663040 3:52236383-52236405 TGGTCCTCACCTCTGCCCTGGGG - Intronic
955556231 3:60140328-60140350 GGGGTATGACCTCAGCCCTGGGG + Intronic
956043900 3:65174905-65174927 GGGTCATGTGCTCATCCCTGTGG + Intergenic
957553411 3:81735623-81735645 GGGTCCTGGATTAATCCCTGGGG - Intronic
960041701 3:113156524-113156546 GGCTCCTGGGCTCATCCCAGTGG - Intergenic
966472708 3:180309637-180309659 GGATACTGAACTCATACCTGTGG + Intergenic
967307729 3:188075434-188075456 GGGACCTGTCCCCAGCCCTGGGG + Intergenic
968477485 4:818889-818911 GGGGCCTCGCCTCATCCCGGGGG + Intronic
971354545 4:25883329-25883351 GGCTGCTGACCTCATACATGGGG + Intronic
971385910 4:26140422-26140444 AGATCCTGACCTCATCCTTTGGG - Intergenic
971514456 4:27469046-27469068 GGGTTCTGCCCTCTACCCTGGGG + Intergenic
975974924 4:80084071-80084093 GGGAACTGATCCCATCCCTGAGG + Intronic
977027189 4:91834363-91834385 GGTTCCTGAGCTCACCACTGGGG - Intergenic
978415712 4:108473948-108473970 GGGTCCTGAGGACAACCCTGTGG + Intergenic
979073731 4:116243684-116243706 GGATACTGTCCTCATCCCTAGGG + Intergenic
979304149 4:119122881-119122903 GAGTCCTGGAATCATCCCTGTGG - Intergenic
985324728 4:188754732-188754754 AGGTCCTGAGCTCTGCCCTGTGG - Intergenic
985540051 5:483639-483661 GGTTCCTGCCCACAGCCCTGCGG + Intronic
985639542 5:1057267-1057289 GGGCCCTGAGTTCAGCCCTGTGG - Intronic
986319380 5:6615626-6615648 GGGTTGTGCCCTCAGCCCTGCGG - Intronic
988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG + Exonic
988833220 5:35007113-35007135 GGGTACTGATCTCATTCATGAGG - Intronic
990512122 5:56498783-56498805 GGGTCCTGAGCCCTTCCCCGTGG + Intergenic
995334467 5:110983612-110983634 GGATCCTGACAACCTCCCTGTGG - Intergenic
995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG + Intronic
997207069 5:132056361-132056383 TGGGCCTGACCCCATCCCTATGG - Intergenic
997209930 5:132071296-132071318 GGGTCCTCACCTTAGCCATGTGG + Intergenic
1000147717 5:158469441-158469463 GGGTCCTGGCCACATCCTTCCGG + Intergenic
1001494715 5:172179587-172179609 GGGCCCTGCCCACAGCCCTGCGG - Intronic
1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG + Exonic
1002328542 5:178425975-178425997 GGGTCCTGAGTTCACCTCTGAGG + Intronic
1005378160 6:25206834-25206856 GGGTCCTGACATCTTAGCTGTGG - Intergenic
1005669401 6:28090043-28090065 GGATTCTGGCCTCTTCCCTGGGG - Intergenic
1007186332 6:39975442-39975464 GGGTCTGGACCTCATCCTTTAGG - Intergenic
1007354884 6:41307070-41307092 GGGTCTTCACCTCCTCTCTGGGG + Intergenic
1012752188 6:103178001-103178023 GGGCCATGACTTCATCCCTCTGG - Intergenic
1013957267 6:115855430-115855452 AGGTCCTGAGCCCAGCCCTGCGG - Intergenic
1018652547 6:166004193-166004215 GGGTGCTGACACCATGCCTGGGG + Intergenic
1019292524 7:257682-257704 GGGTCCTGGCCTCTGGCCTGGGG - Intronic
1019401500 7:856702-856724 GGGCCTTGACCTACTCCCTGAGG - Intronic
1019633263 7:2061534-2061556 GGGTCCTCACCTCCTGCCTTTGG - Intronic
1019662671 7:2233358-2233380 GGGGCCTGACCTCACCCCATTGG - Intergenic
1023747227 7:43332662-43332684 GTGGCCTGTGCTCATCCCTGGGG + Intronic
1023969081 7:44978410-44978432 GGGGCCTGGCCTGAGCCCTGGGG - Intronic
1024308427 7:47947491-47947513 GGGTCCTTACCACATCCCACAGG + Intronic
1026894620 7:74002994-74003016 CGGCCCTGACCTCATGTCTGCGG - Intergenic
1029225977 7:99028722-99028744 GGCCTCTGACCTCATCCCGGAGG + Exonic
1032074961 7:128831890-128831912 GAGTCCTGCAGTCATCCCTGAGG + Intronic
1035234415 7:157487304-157487326 AGGTCCAGTCCTCACCCCTGGGG + Intergenic
1035461192 7:159040248-159040270 GGTTCCTCACATCAACCCTGTGG - Intronic
1035968019 8:4216266-4216288 GAGACCTGACCTTCTCCCTGTGG + Intronic
1037891806 8:22627599-22627621 GGGTCCTGGCTTCACGCCTGGGG - Intronic
1038701457 8:29853192-29853214 GGGGCATAACCTCATCCCTGGGG + Intergenic
1039823365 8:41153364-41153386 TCTCCCTGACCTCATCCCTGTGG + Intergenic
1042013964 8:64285875-64285897 GGGCCTTGGCCTCATCTCTGAGG + Intergenic
1045878888 8:107014865-107014887 AAGTGCTGACCTCATTCCTGAGG - Intergenic
1049234819 8:141507249-141507271 CAGGCCTGACCTCACCCCTGAGG + Intergenic
1049444827 8:142625052-142625074 GGAGCCTGACCTCCACCCTGAGG - Intergenic
1050057746 9:1673407-1673429 GGGGGCTGAACTTATCCCTGGGG + Intergenic
1050150756 9:2617391-2617413 GGGTCCTAACCTACTCCCTTAGG + Intergenic
1050957812 9:11687229-11687251 GGCTCCTGACCTGGGCCCTGAGG - Intergenic
1053423548 9:37996413-37996435 GGGTCCTTAACTCAGGCCTGAGG + Intronic
1055307038 9:74940830-74940852 TGGTCCCAGCCTCATCCCTGAGG - Intergenic
1056806028 9:89729381-89729403 GGGCCATGACCTCATGACTGCGG + Intergenic
1057021098 9:91698159-91698181 GGGTCCTGCCCCCTACCCTGGGG + Intronic
1057405621 9:94768181-94768203 AGGCCCTGACCTGATCTCTGGGG - Intronic
1057816096 9:98296156-98296178 GGGCCCTAACCTCATCCATGCGG - Intronic
1060444696 9:123677384-123677406 GGCTGCTGACCTCAGTCCTGTGG + Intronic
1060794697 9:126505874-126505896 GGGTCTTGGCCTCATCCCTCAGG + Exonic
1061256881 9:129458740-129458762 GGGTGCTGACCTCGCCCCTGTGG - Intergenic
1061425882 9:130498113-130498135 GGGTCCTGAACAAATCACTGGGG + Intronic
1061482264 9:130903064-130903086 GGGTGATGACCCCTTCCCTGAGG - Exonic
1061767942 9:132894108-132894130 GGGTCCTCAGCTCATCCATGCGG - Exonic
1061820478 9:133224981-133225003 CGGTCCTGACTGCATTCCTGGGG - Intergenic
1062213759 9:135378154-135378176 GGCTCAGGCCCTCATCCCTGAGG + Intergenic
1062238790 9:135525077-135525099 CGGTCCTGACTGCATTCCTGGGG + Intronic
1062432853 9:136533650-136533672 GTGTCCTGCCCTCGACCCTGCGG - Intronic
1062577257 9:137214513-137214535 GGGCCCCGACATCCTCCCTGCGG + Intronic
1189556493 X:42150856-42150878 GGGTCTTGAACATATCCCTGTGG + Intergenic
1189976250 X:46463357-46463379 GGCTCCTGAGCACATCCCAGAGG - Intronic
1190041589 X:47076802-47076824 GAGGCCTCATCTCATCCCTGTGG - Intergenic
1191253571 X:58270465-58270487 GCGTCCTGTCCCCATCCCCGGGG + Intergenic