ID: 1002181415

View in Genome Browser
Species Human (GRCh38)
Location 5:177432924-177432946
Sequence CAGGTCACACAGCAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 785
Summary {0: 1, 1: 1, 2: 6, 3: 93, 4: 684}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002181415_1002181425 23 Left 1002181415 5:177432924-177432946 CCTTGCCCCTGCTGTGTGACCTG 0: 1
1: 1
2: 6
3: 93
4: 684
Right 1002181425 5:177432970-177432992 AGCACCCACAGCTTCAGCACAGG 0: 1
1: 0
2: 1
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002181415 Original CRISPR CAGGTCACACAGCAGGGGCA AGG (reversed) Intronic
900000920 1:14518-14540 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900020634 1:185039-185061 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900474534 1:2869929-2869951 CCGGGCACACAGCAGGCACAAGG - Intergenic
900482609 1:2906469-2906491 AAGGTCACACACCAGGGCCCTGG - Intergenic
900679169 1:3906883-3906905 TTGGTCAAACATCAGGGGCATGG + Intergenic
900933421 1:5750827-5750849 CACGTCAGAAACCAGGGGCAGGG - Intergenic
900992520 1:6104477-6104499 CAGGGCACAGGGCAGGGCCAGGG + Exonic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902040656 1:13489970-13489992 CAGGTCACACCCCTGGTGCAGGG - Intronic
902384771 1:16070149-16070171 CAGGTCACATGGCCAGGGCATGG - Intronic
902664184 1:17926038-17926060 TGGGTCACACAGCAAGGTCACGG + Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902696866 1:18146023-18146045 AAGGTCACACAGCAGAGCCAGGG - Intronic
902792902 1:18781207-18781229 AAGATCACACAGCAGGTACAAGG - Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
902997003 1:20233624-20233646 CATGTCACACTGCTGGGGAATGG + Intergenic
903018477 1:20377236-20377258 GAGGTCACACAGCTGGGACCTGG - Intergenic
903164787 1:21512586-21512608 CAGGTCACACAGCTGGCGATTGG - Intronic
903267441 1:22166313-22166335 AAGGTCACACAGCAGGTGAGTGG + Intergenic
903367853 1:22815996-22816018 CAGGTGACACAGCACGTGAATGG - Intronic
903678861 1:25083682-25083704 GAGGTCACACAGCAAAGTCATGG + Intergenic
903694508 1:25197151-25197173 CAGGTCTCAGGGCCGGGGCAGGG - Intergenic
903787434 1:25870611-25870633 AAGATCACACAGCAGGGCAAAGG + Exonic
904032623 1:27542741-27542763 CACGTCCCAGAGCAGGGCCACGG - Intronic
904282250 1:29428852-29428874 AAGGTCACACAACTGGTGCATGG - Intergenic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904346985 1:29879125-29879147 CAGTCCACAGAGCAGGGGAAGGG - Intergenic
904400077 1:30250464-30250486 GAGGTCACGCAGCTGGGGAATGG - Intergenic
904420534 1:30388111-30388133 TGGGTCCCACATCAGGGGCAGGG - Intergenic
905104086 1:35552461-35552483 AAGGTCACACAGCAAGAACATGG - Intronic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905924682 1:41741135-41741157 CAGATCACACAGCTAGAGCAGGG + Intronic
906072734 1:43029012-43029034 CAGGTCACACGGCTCTGGCATGG - Intergenic
906285595 1:44585723-44585745 AAGGTCACACAGCAGAGCCAAGG - Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906975881 1:50572646-50572668 AAGGTCACATAGCAGGGCAATGG - Intronic
907150780 1:52285388-52285410 CAGGCCACACAGCAGAGGTGAGG + Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
907460647 1:54603588-54603610 GAGGTCACTCAGCAGGGGTATGG + Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908200241 1:61787912-61787934 CAGGTAAGGCTGCAGGGGCAGGG - Exonic
908254985 1:62295647-62295669 CACCTCATACAGCAGGGCCAAGG + Intronic
911041836 1:93597489-93597511 GAGGCCACACAGCAGGTGCGTGG - Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
914239991 1:145846804-145846826 CAGATGACACAGCAGGGACATGG - Intronic
915129739 1:153688101-153688123 CAGGTGACTCTGCAGGGCCAGGG - Exonic
915319194 1:155046989-155047011 CAGCTCTCACAGCAGGGGAGGGG + Intronic
915598503 1:156908437-156908459 CAGGTGTCACAGAAGGGGAAAGG + Intronic
916046251 1:161001968-161001990 AAGATCACACAGCTGGGGCCAGG + Intronic
916211996 1:162367097-162367119 GGGGTCACAGAGCACGGGCAGGG - Exonic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918109704 1:181444669-181444691 GGGGTCAGACAGGAGGGGCAGGG - Intronic
918306389 1:183250576-183250598 CAGGTCAGCCAGCAGGTGTAGGG - Exonic
919250868 1:195054565-195054587 CAGGCCACACAGGAGGGGGTGGG - Intergenic
920308543 1:205034287-205034309 CAGGGCACACAGCATGGAGAGGG - Intergenic
920420673 1:205831135-205831157 CAGGTCACCTAGCAGAGGCTGGG + Intronic
921818431 1:219589928-219589950 CAAGTCACACAGCAGAGCCAGGG + Intergenic
922289317 1:224197486-224197508 GAGGTCACACAACATGGGCCAGG + Intergenic
923516812 1:234704533-234704555 GAGGTCTCAAAGGAGGGGCAGGG + Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
923907499 1:238401769-238401791 CACCTCACACAGCCGGAGCAGGG + Intergenic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924802828 1:247340032-247340054 CAGGACACACAACAGGGTCTGGG - Intergenic
924824429 1:247524367-247524389 GAAGTCACACAGCATGGGTATGG - Intronic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1064020299 10:11803822-11803844 CAGGCCACAGAGCAGTGCCAGGG + Intergenic
1067046907 10:42990149-42990171 CAGGCCACAGACAAGGGGCAGGG + Intergenic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067346213 10:45440819-45440841 CAGGACACGCGGCTGGGGCATGG + Intronic
1067430066 10:46236951-46236973 CAGGTCACACACCAAGTTCAAGG + Intergenic
1067999417 10:51314169-51314191 AAGGTCACACAGCAACGTCATGG + Intronic
1069788833 10:71006479-71006501 GAGGCCACACAGCTTGGGCAGGG + Intergenic
1070059841 10:72971207-72971229 CAGGCCACAGTGCAGTGGCATGG - Intergenic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1070606967 10:77905526-77905548 TAGTTGACACAGCAGGGACAAGG - Intronic
1070646211 10:78204062-78204084 CAGGTCACAGAGCTGGGGAGTGG - Intergenic
1070754897 10:78985815-78985837 CAGGTCACACAGCAGGTCAGTGG + Intergenic
1070853008 10:79583069-79583091 CAGGTCACACAGCCGGGAAGTGG - Intergenic
1070864913 10:79702495-79702517 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1070878702 10:79840627-79840649 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1070888072 10:79922236-79922258 CAGGTCACACAGCCGGGAAGTGG + Intergenic
1071512241 10:86269378-86269400 GAGGCCACACAGCAGGAGCTGGG - Intronic
1071631807 10:87224716-87224738 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071645261 10:87356937-87356959 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071845648 10:89518671-89518693 CAGGTCACACAGCAAGTCAATGG - Intronic
1072207415 10:93216563-93216585 CAAATCACACAGGAGTGGCATGG - Intergenic
1072538135 10:96378666-96378688 AAGGTCACACAGCTAGGGAACGG + Intronic
1073072162 10:100801550-100801572 AAGGTCACACAACTGGGGAATGG - Intronic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073459709 10:103659626-103659648 GAGGCCTCACAGCAGGGACATGG + Intronic
1074720456 10:116259934-116259956 CAGGACACACGGCAGGGGAAGGG + Intronic
1075159565 10:120011491-120011513 CAGGTGGCACAGGAGGGACAAGG + Intergenic
1075461380 10:122618674-122618696 CAGCACAGATAGCAGGGGCAGGG + Intronic
1075571853 10:123551997-123552019 CATGTCACACAGCTGGTGAATGG + Intergenic
1075623358 10:123944130-123944152 GAGGTCACACAGCAGGCAAAAGG - Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1075933420 10:126319278-126319300 CAGGCAACACAGCATGGGAAGGG + Intronic
1075962584 10:126582090-126582112 CAAGTCCCACAGCAGCTGCAGGG - Intronic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1076813855 10:132904578-132904600 CAATTTACACAGCAGTGGCACGG + Intronic
1077036173 11:495565-495587 CAGGCCGGACAGCAGGGCCAAGG + Intronic
1077415483 11:2422566-2422588 CAGGTCACACAGCAGGTCAAGGG - Intronic
1077674015 11:4181746-4181768 AAGATCACACAGCAAGGCCATGG - Intergenic
1077866822 11:6229232-6229254 AAAGTCACACAGCTGGGGAATGG - Intronic
1078082334 11:8213259-8213281 CAGGGCAGACAGCAGGGGTGAGG - Intergenic
1078352600 11:10606911-10606933 CAGGTGACAGAGCACAGGCAAGG - Intronic
1079100407 11:17538189-17538211 CAGGGCTGGCAGCAGGGGCAGGG - Intronic
1080283987 11:30586783-30586805 CAGGGCTCACCGCAGGGGTAAGG + Intronic
1080525726 11:33115009-33115031 CTGGGCACATAGCAGAGGCAGGG + Intronic
1080540315 11:33258076-33258098 CGGGCCACACTGCAGGGGCTAGG - Intronic
1080690078 11:34549130-34549152 CAGGGCACACAGTTTGGGCAGGG - Intergenic
1080855312 11:36106807-36106829 CAGGTCACACAGCAGAGGGAGGG - Intronic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081664561 11:44909305-44909327 AAGGTCACACAGCAAGTTCATGG - Intronic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081760544 11:45573870-45573892 AAGGTCACACAGCAGGTGACTGG + Intergenic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1083220294 11:61248164-61248186 AAGGTCACACAGCGGGGGAGTGG - Intronic
1083332706 11:61906361-61906383 CAGGTCACACAGCATGGGGCAGG + Intronic
1083668414 11:64287455-64287477 CAGGTAAGACAGCAGGATCAAGG + Intronic
1083988083 11:66230045-66230067 CGGGACACACAGCAGTGGCTTGG + Intronic
1084033532 11:66494528-66494550 CAGCCCACACAGCAGGGGTCAGG - Intronic
1084199163 11:67543761-67543783 AAGGTCACACAGCTGGGTAAAGG - Intergenic
1084301348 11:68254602-68254624 CAGGGCCCACGGCAGGGGCCTGG - Intergenic
1084433475 11:69124080-69124102 CAGGTCACACAGCAAGGCCTTGG - Intergenic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084717363 11:70882550-70882572 TAGGTCACAGAACAGGAGCAGGG + Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1085041798 11:73331158-73331180 AAGGTCACACAGCAAGTCCAGGG - Intronic
1086329928 11:85743865-85743887 CAGGTGCCACAGAAGGGGAAAGG - Intronic
1086850732 11:91804421-91804443 CTGATCACACAGCAGGGGAGAGG + Intergenic
1088912506 11:114202453-114202475 CAGGTCACACAGAAGGCCCTGGG - Intronic
1089003107 11:115068528-115068550 CAGAACCCACAGCAGGGGCCAGG + Intergenic
1089344863 11:117784724-117784746 GAGGTCACACAGCAGGTGAGGGG - Intronic
1089348289 11:117805954-117805976 CAGGTCACATGGCAGAGTCAGGG + Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1089554301 11:119307140-119307162 GAAGTCTCACAGCAGGGGAAAGG - Exonic
1089756492 11:120691348-120691370 CTGGTCACATCGCAGGGGCCTGG - Intronic
1089797998 11:120998905-120998927 CAGGTATCACAGCAGGTGTATGG - Intergenic
1090203226 11:124870518-124870540 CAGGACAGACACCAGGGTCAAGG - Intronic
1090749774 11:129735188-129735210 CAGGTCACACCTCTGGGGCATGG + Intergenic
1090873590 11:130769391-130769413 CTGTTCACATAGCAGGGTCAGGG + Intergenic
1091046031 11:132326467-132326489 CTGGTCACTGAGCAGGGGCAAGG + Intronic
1091213913 11:133887894-133887916 GAGGACACAGAGCAGGGGAATGG - Intergenic
1091329975 11:134724759-134724781 CAGGGCCCCCAGCAGAGGCAGGG - Intergenic
1091374008 12:14633-14655 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091822077 12:3483034-3483056 CAGGTCACACAGCAAGGTGTGGG - Intronic
1091862890 12:3802658-3802680 GAAGTCACACTGCAGTGGCATGG - Intronic
1092024840 12:5231898-5231920 CAGGGCTCACAGGAGGGGCTCGG - Intergenic
1092290838 12:7158673-7158695 CAGGTCACGGAGGAGGGGCCGGG - Exonic
1093552545 12:20432135-20432157 AAAGTCACACAGAAGTGGCATGG + Intronic
1095076248 12:37930294-37930316 CAGGTCACACAACAGGAGTATGG - Intergenic
1095396863 12:41771772-41771794 CAGGTGCCTCTGCAGGGGCATGG - Intergenic
1095950583 12:47779739-47779761 CAGGCCACACAGCAGGTGAGGGG + Intronic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1098486788 12:71030848-71030870 CAGATGACACAGCAGGCACAGGG + Intergenic
1098803528 12:74992221-74992243 CAGACCACACAGCAGGACCAGGG + Intergenic
1100891082 12:99126599-99126621 CCTGTCACAAAGCAGGGGAAGGG + Intronic
1101451834 12:104786942-104786964 GAGGTCAGACAGCACAGGCAGGG + Intergenic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101739550 12:107490277-107490299 CAGGGCACATATCATGGGCAAGG + Intronic
1101853936 12:108426653-108426675 CAGGTTACACAGCTGGGAAAAGG + Intergenic
1102224163 12:111216256-111216278 AAGGTCACACAGCAAGTGAATGG - Intronic
1102508556 12:113399068-113399090 CAGGACACACAGCAGAGGACAGG + Intronic
1102550039 12:113684987-113685009 AAGGTCACACAGCAAGGGTACGG - Intergenic
1102555626 12:113724787-113724809 AAGGTCACACAGCAGGTCCTTGG + Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102956203 12:117060695-117060717 CAGCTCACCCAGTGGGGGCATGG + Intronic
1103123216 12:118398308-118398330 TAGGTCACACAGCCGTTGCAGGG + Intronic
1103245061 12:119449748-119449770 CAGGTCAATCAGCAGGTTCATGG + Intronic
1103505253 12:121438675-121438697 CATGCCTCATAGCAGGGGCATGG - Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103621399 12:122189527-122189549 CAAGACACAGGGCAGGGGCAGGG - Intronic
1103643395 12:122371266-122371288 CAAGTCCCAAAGCAGTGGCATGG + Intronic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1103961795 12:124613621-124613643 CAGGTCACACAGCTAGGGAGTGG + Intergenic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1104199735 12:126576995-126577017 CAGGTGGGACAGCAGAGGCAGGG + Intergenic
1104224808 12:126821016-126821038 CAGGTCACCTAGCAGGTCCATGG - Intergenic
1104411087 12:128558432-128558454 CAGGTAAGACAGCATGTGCAGGG - Intronic
1104884070 12:132094627-132094649 CAGGACAAGCAGCAGAGGCATGG - Intronic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105411500 13:20175074-20175096 CAGGACACACCCCAGGGGCGAGG + Intergenic
1105497856 13:20946244-20946266 CAGGTCCTACCGCAGCGGCACGG - Intergenic
1106419047 13:29570371-29570393 AAGTTCACACAGCGAGGGCAGGG - Intronic
1107975101 13:45680749-45680771 CAGGTCAGCCTTCAGGGGCAGGG + Intergenic
1107979552 13:45721372-45721394 CAGGTCTCAGGGCAGAGGCAAGG + Intergenic
1111643724 13:91003564-91003586 CAAGTCACACAGCTGGGAAAGGG - Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1111799854 13:92968243-92968265 CAGGTCAAATGGCAGAGGCATGG - Intergenic
1112381094 13:98891052-98891074 CAGCTCACACCGCAGGCACAGGG - Intronic
1113868440 13:113543684-113543706 CAGGTCACACGCCACGGCCAGGG - Intronic
1113959123 13:114116044-114116066 CAGGTCACACAGCCAGAGCCTGG + Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1114818638 14:25989582-25989604 CAGGGCACACAGCAAAGCCAAGG - Intergenic
1114856713 14:26455391-26455413 AAGGTCACATAGCAGAGCCAGGG - Intronic
1116076066 14:40112626-40112648 CAGGGCAGCCAGCAGGGGTAGGG + Intergenic
1119690971 14:76672246-76672268 CAGCTCTCACAGAAAGGGCAGGG - Intergenic
1120203901 14:81567396-81567418 CAGGTCATGTGGCAGGGGCAGGG + Intergenic
1120588607 14:86347421-86347443 CACATCACTCAGCAGGGGCTGGG + Intergenic
1121422065 14:93823394-93823416 CAGGTCACACAGCTGAGAAAGGG + Intergenic
1121618437 14:95329864-95329886 AAGGTCACACAGCAGGGTGAGGG + Intergenic
1122004771 14:98693106-98693128 AAGGTCACACAGCCAGTGCATGG + Intergenic
1122142664 14:99672179-99672201 CAGGCCACACAGTAGGTGCATGG + Intronic
1122651535 14:103229508-103229530 CAGGTCCCCAAGCAGGGCCAGGG + Intergenic
1122693828 14:103543422-103543444 CAGGTCACCCAGCAGGGCAGCGG + Intergenic
1122984042 14:105204016-105204038 CAGGTCACACAGCACTGGTGTGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1125094090 15:35831050-35831072 CAGGTTACAAAGCAAGGGTATGG - Intergenic
1125755676 15:42063058-42063080 AAGGTCACACAGCAAGCCCAGGG - Intergenic
1126096747 15:45095630-45095652 CTGGTCTCAGAGCTGGGGCAGGG - Intronic
1127259820 15:57319638-57319660 CATCTCTCACAGCAGGAGCAGGG - Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127960815 15:63888979-63889001 CAGGTCACACAGCTGGGGAGAGG - Intergenic
1128349476 15:66879589-66879611 AAAGTCACACAGCAGGGTAATGG - Intergenic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1129379236 15:75154926-75154948 CAGAACACCCAGCAGGGTCAGGG - Intergenic
1129695552 15:77738938-77738960 CAGGACACACTGCAAAGGCAGGG + Intronic
1130216823 15:81979494-81979516 CAGGTCAGAGAGCATGTGCAGGG - Intergenic
1130959981 15:88652875-88652897 TATGTCTCACAGCAGGGGCCGGG + Intronic
1131770201 15:95728947-95728969 CAGGTCACACGGCAGTAGCAGGG - Intergenic
1131831641 15:96358699-96358721 AGGGTCACACTGCAGGCGCAGGG - Intergenic
1132214229 15:100050820-100050842 CAGGGCACATAGAAGGGTCATGG - Intronic
1132452590 15:101976422-101976444 GAGGCCACACAGCTGGGGCGGGG + Intergenic
1132454310 16:14204-14226 GAGGCCACACAGCTGGGGCGGGG - Exonic
1132540382 16:505705-505727 TACCTCACACAGCAGGGGCTTGG + Intronic
1132646048 16:999796-999818 CAGCTCAGCCAGCAGGGGCCAGG + Intergenic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1133002875 16:2859969-2859991 CAAGTCAAACAGCAGGGCCCTGG + Intergenic
1133076598 16:3285056-3285078 CAGGTCACAAACCATGGGCGGGG + Exonic
1133320465 16:4910436-4910458 AAGGTCACCCAGCAAGGACAAGG + Intronic
1133424160 16:5673216-5673238 GAAGTCACAGAGAAGGGGCAAGG + Intergenic
1133603089 16:7359149-7359171 AAGGTCACACAGCATTTGCACGG - Intronic
1134045862 16:11100404-11100426 CAGCTTTCACAGCAGGAGCAGGG - Intronic
1134860297 16:17554742-17554764 CAGGTCACACAGCTGATGAATGG - Intergenic
1135629060 16:24021712-24021734 AAGGTCACAAAGCAAGGACATGG - Intronic
1135737728 16:24945875-24945897 AAGGTCACACAGCAGGGAACTGG - Intronic
1135764920 16:25169211-25169233 CAGGTCAGAGAGCAGGGACTGGG + Exonic
1135990064 16:27213049-27213071 CAGGTCACCCAGCTGGGAGATGG + Intronic
1136036795 16:27546731-27546753 CAGATAACACAGAGGGGGCAAGG - Intronic
1136038642 16:27560603-27560625 CAGGGAACACAGCACAGGCAAGG - Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1136577074 16:31131264-31131286 CAGGTCCGACAGCAGGGGCCAGG - Exonic
1136598312 16:31266723-31266745 CAGGTCACACTGCAGAGGAGGGG + Intronic
1137560072 16:49496849-49496871 CTGGTCCCACAGAAGTGGCAGGG - Intronic
1138086861 16:54141342-54141364 AAGGTCACACAGCTGGGGAGTGG - Intergenic
1138094283 16:54199951-54199973 CAGCTGACAGAGCAGGGGCCGGG + Intergenic
1138170079 16:54840686-54840708 CAGTCCCCACAGCAGGGGAAGGG + Intergenic
1138414809 16:56865542-56865564 GAGGTCACACAGCAGGGAAGTGG - Intronic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139358791 16:66383667-66383689 CAGGTTACAGAGCTGAGGCATGG + Intronic
1139935642 16:70569004-70569026 CAAGTCACACTGCTGGGGCCCGG - Intronic
1141135005 16:81459379-81459401 GAGGTCACGGAGCAGGGTCACGG - Intronic
1141829447 16:86501580-86501602 CATGTCACACAGCAGTGGAGCGG + Intergenic
1141917157 16:87106973-87106995 TAGGTCACACAGCTAGTGCATGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142291953 16:89197258-89197280 CCGGCCACACAGCAGGGTCCAGG - Intronic
1142482255 17:226269-226291 CAGGTGACACAGCAGGCGCCAGG + Intronic
1142814769 17:2416525-2416547 CAGGACACACAGCAGAGGTCTGG + Exonic
1142982280 17:3679158-3679180 CAAGTCACACAGCCGGTGAATGG - Intronic
1143037757 17:4009469-4009491 CAGGCCACACAGGACAGGCATGG - Intronic
1143303263 17:5926753-5926775 AAGGTCACACAGCCAGGACATGG + Intronic
1143365622 17:6406664-6406686 AAGGTCACACAGCAGGTCCGTGG - Intronic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143965554 17:10754338-10754360 AAGGTCACACAGCAAGGACCTGG - Intergenic
1144761690 17:17710853-17710875 AAGGTCACACAGCAAGTTCATGG + Intronic
1144764903 17:17727308-17727330 AAGGTCACACAGCAGTTGCTGGG + Intronic
1144848151 17:18230712-18230734 AAGGCCACACAGGAGGGGTAGGG - Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1146212417 17:30952866-30952888 CAGGCCACAGAGAAGGGGCTGGG - Intronic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146626428 17:34438744-34438766 CAGGTCACACAGCAAGGAATGGG - Intergenic
1146888038 17:36485510-36485532 CAGGTCACACAGCCAGGGAGGGG + Intergenic
1147048855 17:37775718-37775740 GAGGTCACACAGACGTGGCAGGG + Intergenic
1147188366 17:38725053-38725075 CAGGTACCTCAGCAGGGGGAAGG + Intronic
1147359910 17:39923978-39924000 CAGCCCACAGGGCAGGGGCAGGG + Intronic
1147365622 17:39957316-39957338 CAGGACACAGAGCAGTGTCAAGG - Intergenic
1147513532 17:41094551-41094573 CAAGTCCCACAGAAGGGTCAGGG + Intronic
1147544956 17:41394035-41394057 CAGGGCCCACAGCGGGGGCGTGG + Exonic
1148204885 17:45774061-45774083 AAGGCCACACAGCAAGGGGATGG + Intergenic
1148344915 17:46896839-46896861 AAAGTCACACAGCATGGGCCTGG + Intergenic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148397211 17:47318669-47318691 AATGTAAAACAGCAGGGGCAGGG + Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149043016 17:52212414-52212436 AGGGTCACACAGAAAGGGCAAGG + Intergenic
1150008889 17:61487001-61487023 CAGCTCAGCCAGCAGGGGAAAGG + Intergenic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1151705369 17:75764503-75764525 GAGGTCACACAGCAGGTTCTTGG - Intronic
1151942885 17:77303855-77303877 CAGGGCCCACAGCAAGGGCCTGG + Intronic
1152015318 17:77746897-77746919 CAGGTGCCACAGCAGGAACAAGG - Intergenic
1152094837 17:78266984-78267006 CAGGTCCTTGAGCAGGGGCATGG + Intergenic
1152430194 17:80244511-80244533 CTGGTCACACAGGAGAGGCTGGG + Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153681086 18:7501594-7501616 CAGGTCCCACAGGTGAGGCAGGG + Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1154300279 18:13186001-13186023 CAGAGCCCACAGCAAGGGCAGGG - Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1154325914 18:13390304-13390326 AAGGACACATAGCAGGAGCACGG - Intronic
1154969079 18:21389054-21389076 CAGATCACACTGAAGGAGCAGGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1157314205 18:46574832-46574854 AAAGTCACACAGCAGGTGGACGG + Intronic
1157560551 18:48642605-48642627 CAAGGCACACAACAGGGGCTGGG - Intronic
1157685643 18:49640533-49640555 CAGGTGGCACAGCCAGGGCAGGG - Intergenic
1158084925 18:53639834-53639856 TGGGTCACACAGCAGGGAGAAGG + Intergenic
1160497819 18:79385402-79385424 CAGGCCACACCGCCGGGGCCAGG + Intergenic
1160604216 18:80037253-80037275 CAAGTCACACAGCAGGGGCTGGG - Intronic
1160691304 19:461616-461638 CAGGCCGCAGAGCAGGGGCCCGG - Intergenic
1160743162 19:696892-696914 CAGCTCACACAGCCGGGTGATGG + Intergenic
1160814132 19:1027597-1027619 AGGGTCACACAGCAGGGTCCTGG + Intronic
1161069855 19:2254542-2254564 CACGTCACCCAGCAGGGCCAGGG - Intronic
1161124097 19:2546325-2546347 CAGGTCGCCCAGCAGGGCCTGGG + Intronic
1161153244 19:2720482-2720504 AAGGTCACAGAGCAGGGGGGTGG + Intronic
1161203174 19:3027524-3027546 GAGGGCACATAGCAGAGGCAGGG - Intronic
1161208047 19:3052252-3052274 CAGGTCACACAGCATGGCCCAGG - Intergenic
1161443242 19:4304424-4304446 GAGGTCCCACGGCAGGGCCAGGG + Intergenic
1161485901 19:4535503-4535525 AAGGTCACTCAGCAGGGCTATGG - Intronic
1161582955 19:5090748-5090770 AAGGTCACACAGCAGGAGGCTGG + Intronic
1161606710 19:5219140-5219162 AAGGTCACACAGCATGGGAATGG - Intronic
1162305312 19:9869419-9869441 GAGGTCACACAGCAAGCGAATGG - Intronic
1162552319 19:11364581-11364603 CAGGTCCCGCAGCAGGGGCGTGG - Exonic
1163291332 19:16381280-16381302 CACATCACACAGCAGGTCCACGG + Intronic
1163325596 19:16601108-16601130 GAGGTCACACAGCTGGGTCTGGG + Intronic
1163641958 19:18467040-18467062 AAGGCCACACAGCAGGGCCGGGG - Intronic
1164472068 19:28544673-28544695 CAGCTTACAGAGGAGGGGCATGG - Intergenic
1164791591 19:30989991-30990013 GAGGTCACACAGCAAGATCATGG + Intergenic
1164823592 19:31268114-31268136 CAGGCAAGACAGCATGGGCAGGG - Intergenic
1164910554 19:32007934-32007956 AGGGTCACAGAGCAAGGGCATGG - Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165079055 19:33297486-33297508 CTGGTCTCACAGGAGGGGAAGGG - Intergenic
1165432937 19:35782677-35782699 CAGGTAAACCAGGAGGGGCAGGG + Exonic
1165610428 19:37146744-37146766 CAGGTCACATAGAGGGGGAAAGG - Intronic
1165744402 19:38222302-38222324 TAGGACACACAGCAGGCGCTGGG + Intronic
1165879003 19:39029807-39029829 CTGGTCACACAGCCTGGGCTTGG - Intronic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166049071 19:40247415-40247437 AAGGTCACACAGCAGGGATGTGG + Intronic
1166283476 19:41810007-41810029 GAGGACACTCACCAGGGGCAAGG - Exonic
1166567176 19:43772327-43772349 CAGGTCACACAGCAGAGAGGAGG - Intronic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1166777372 19:45321440-45321462 GGGGTCACACAGCAGGGAAATGG - Intronic
1167285562 19:48596953-48596975 CAGGTCACACAGCCGGGCAGTGG - Intronic
1167819932 19:51918435-51918457 CAGGCCACAGACCAGTGGCAGGG + Intronic
1167849605 19:52191251-52191273 AAGGTCACACAGCAGGTGGGAGG - Intronic
1168113798 19:54209589-54209611 CTGGACACACAGCAGGGAGATGG + Intronic
1168707294 19:58477346-58477368 CAGCTCACGCAGCCGGGCCAGGG - Exonic
1168723928 19:58570508-58570530 CAGGTCACAGTCCAGGTGCAGGG - Exonic
925110125 2:1328042-1328064 CACGTCACACAGCCAGAGCAAGG + Intronic
925117129 2:1389121-1389143 CAGCTCACTCAGGAGGGGCAGGG + Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925836420 2:7951202-7951224 CAGGCCACACGGCGGGGGCTGGG - Intergenic
926212480 2:10880949-10880971 AAGGTCACACGGCAGGTCCATGG - Intergenic
928179734 2:29060269-29060291 CAGGTCACAGAGCCAGGGGATGG + Exonic
929279780 2:40065211-40065233 CAGGTCACACAGCAGATGAATGG + Intergenic
929428031 2:41863823-41863845 CAGGTCACACAGCTTGGGTCCGG - Intergenic
929605717 2:43232815-43232837 CAGATCACACAGGACGGCCAGGG + Exonic
929821160 2:45274817-45274839 CAGCTCAGACAGCAGGTGGAAGG + Intergenic
931664516 2:64600560-64600582 CAAGTCACATAGCCTGGGCACGG + Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
932859616 2:75276277-75276299 AAGGTCACACAGCTAGTGCATGG + Intergenic
933307331 2:80618647-80618669 AAGGTCACACAGCAGGGCGATGG + Intronic
933813579 2:86048466-86048488 AAGGTCACACAGCAAGTTCAAGG + Intronic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
934634416 2:95970150-95970172 CAGGATACAGAGCAGGGTCAAGG + Intronic
934799215 2:97135089-97135111 CAGGATACAGAGCAGGGTCAAGG - Intronic
935091087 2:99895672-99895694 CAGAGCACACAGCAGGGACTCGG + Intronic
935443787 2:103135555-103135577 CAGGTCAGCCAGCAGGGTGAAGG + Intergenic
936029409 2:109059277-109059299 AAGGTCACACAGCATGGGGCTGG + Intergenic
936155254 2:110042828-110042850 CAGGTTACACTGCAGTGACAAGG - Intergenic
936189426 2:110328585-110328607 CAGGTTACACTGCAGTGACAAGG + Intergenic
936553267 2:113469414-113469436 CAGGTCACAAACAAGGGGCACGG - Intronic
936568803 2:113598896-113598918 GAGGCCACACAGCTGGGGCGGGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
937127127 2:119482051-119482073 CAGGCCACACAGCCAGGACATGG + Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938076854 2:128344339-128344361 CAGGTCACACAGCTAGAGAATGG - Intergenic
938717043 2:134030234-134030256 AAGGTCATACAGCAAGGTCATGG - Intergenic
939332507 2:140782921-140782943 AAGGTCACACAGCAGGAGTATGG + Intronic
939995058 2:148912181-148912203 CAAGTCAGGAAGCAGGGGCAGGG + Intronic
943099455 2:183471013-183471035 CTGGACACACCGCAGGGTCAGGG - Intergenic
946469635 2:219946641-219946663 GAGGTCACATAGCAGGTGGATGG - Intergenic
947526131 2:230877807-230877829 GAGGTCACACAGCAGGGAGGTGG + Intronic
947578321 2:231294365-231294387 CAGGTCACTGGGCAGGAGCAAGG + Intronic
947717593 2:232349674-232349696 CAGGTCACCAACCTGGGGCAGGG + Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947976873 2:234374274-234374296 CAGGTTACAGAGGAGGGGCGGGG + Intergenic
948329506 2:237154016-237154038 AAGGTCACACAGCAGAGGGAAGG - Intergenic
948425760 2:237885840-237885862 CAGAGCACACCCCAGGGGCACGG + Intronic
948433529 2:237936287-237936309 CAGCACACACAGCCTGGGCACGG + Intergenic
948480994 2:238250347-238250369 CTGGCCACACTGCAGGGCCAGGG + Intronic
948591054 2:239050429-239050451 CATGGCACAGAGCAGTGGCAGGG - Exonic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948843357 2:240670808-240670830 CAGGTAACACAGTAGCTGCAGGG - Intergenic
1168751291 20:283744-283766 CAGGTCACACAGCCAGGAAATGG - Intronic
1168789296 20:565438-565460 CAGGTCACACAGCCAGGAAATGG + Intergenic
1168816169 20:738841-738863 TAGGTCACACAGCAAGTCCATGG - Intergenic
1168818967 20:760947-760969 CAGGTCACAGAGCAAGGGGCAGG - Exonic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1168982876 20:2022871-2022893 AAGGTCACACAGCAAGTACATGG - Intergenic
1169200268 20:3705920-3705942 CAGGTCAGACTGCAGTGGCAAGG - Exonic
1169268526 20:4182106-4182128 CAGCTCACACAGCATGGACGAGG + Exonic
1169602355 20:7276103-7276125 CAGGTCACACAGCTGTGAGAAGG - Intergenic
1169876433 20:10302392-10302414 CAGGTCACAGAGCTGGTGAATGG - Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170412561 20:16107071-16107093 AAGGTCACCCAGCAAGGGAAGGG + Intergenic
1170761439 20:19254709-19254731 GAGGACACACAGCATGGGCTGGG + Intronic
1172106296 20:32519084-32519106 CAGGACACACAGCAGCTGAATGG + Intronic
1172181730 20:33007868-33007890 CAGGTCCTACAGCAAGGCCAGGG - Intronic
1172293484 20:33792074-33792096 AAGGTCACACAGCAAGTGCATGG - Exonic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1172870499 20:38132599-38132621 GGGGTCACACAGCGGGGGAATGG + Intronic
1173456757 20:43208800-43208822 AAGGTCACACAGCCAGGGAATGG - Intergenic
1173617780 20:44414135-44414157 AAGGTCACTCAGCAAGGGAAGGG - Intronic
1173810364 20:45951693-45951715 CAGGCCACACAGCAGGTGAGCGG - Intronic
1173940458 20:46906712-46906734 AAGGTCACCCAGCAAGTGCAGGG + Intronic
1173943976 20:46935312-46935334 CAGGTCACACAGCCAGTGCATGG - Intronic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174327568 20:49791450-49791472 GAGGTCACACTACAGGGGAATGG + Intergenic
1174359036 20:50016349-50016371 TGGGTCACACAGCAGGGAGAGGG - Intergenic
1174424266 20:50420889-50420911 GAGGCCACACAGCAGGGGAGGGG - Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174596448 20:51688041-51688063 GAGGTCACACAGCAGGTGAAAGG - Intronic
1174645958 20:52085512-52085534 CAGGTCAAACAGCAGGGATTTGG + Intronic
1174819564 20:53714718-53714740 CAGGTCACACAGCTAGGCAACGG - Intergenic
1175371420 20:58495607-58495629 CACCTCACTCAGAAGGGGCAGGG - Intronic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1176035718 20:63035545-63035567 CAGGTGACGGAGCAGGGGAATGG - Intergenic
1176056667 20:63152581-63152603 AAGGTCACACAGCAGGTGTGTGG + Intergenic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176214694 20:63942433-63942455 CGGGTCACACAGCAGCACCACGG + Intronic
1176310359 21:5145927-5145949 CAGCTCAGACAGCCGAGGCAGGG + Intronic
1176379484 21:6104896-6104918 CAGGCCACACTGCAGGGGCTGGG + Intergenic
1178499011 21:33110459-33110481 AGGGTCACACAGCAAGGGCTGGG - Intergenic
1178592727 21:33924975-33924997 CAAGTCACACAGCTGGTGAAGGG - Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1178898233 21:36578155-36578177 CATGTCACATTGCAAGGGCATGG - Intergenic
1178955534 21:37018222-37018244 CAGGTCCCAGAGCAGGGCCCAGG - Exonic
1178958766 21:37045267-37045289 CAGGCCAACAAGCAGGGGCACGG + Intergenic
1179646241 21:42778077-42778099 CAGGTGACACAGGAGGGGACGGG - Intergenic
1179743989 21:43433341-43433363 CAGGCCACACTGCAGGGGCTGGG - Intergenic
1179818816 21:43924687-43924709 CAGATGAAACAGCCGGGGCAAGG - Intronic
1179846696 21:44116108-44116130 CAGCTCAGACAGCCGAGGCAGGG - Intronic
1181414040 22:22746562-22746584 CAGGACACTGAGCAGGGGCCTGG + Intronic
1181564518 22:23726810-23726832 TGGGTCATACAGCAGGGGCTGGG - Intergenic
1181573051 22:23778231-23778253 AAAGTCACCCAGCAAGGGCATGG - Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1181778150 22:25174652-25174674 CAAGACACACAGCAGGTGTATGG - Intronic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182146174 22:27998168-27998190 CAGGCCACACAGCCAGGACATGG + Intronic
1182353605 22:29712330-29712352 CAGAGCACACAGCAAGTGCAAGG + Intergenic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183086754 22:35491604-35491626 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086773 22:35491658-35491680 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086786 22:35491694-35491716 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086805 22:35491748-35491770 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086818 22:35491784-35491806 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086831 22:35491820-35491842 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086850 22:35491874-35491896 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086857 22:35491892-35491914 CAGGGGACACATCCGGGGCAGGG - Intergenic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183086876 22:35491946-35491968 CAGGGAACACATCCGGGGCAGGG - Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1183290942 22:37001817-37001839 CAGGTGTCATAGCAGGGGCCAGG - Exonic
1183395108 22:37567032-37567054 CAGGTCACACAGCAAGTGAGGGG - Intronic
1183468870 22:37995082-37995104 AAGATCACACAGCAGGAGCTGGG - Intronic
1183669581 22:39264612-39264634 GAGGTCACAAGGCAGGGACAGGG - Intergenic
1183722565 22:39571068-39571090 CAGGTCTCCCAGCCGGAGCAAGG - Intronic
1183732293 22:39625437-39625459 CAGGTCACACAGCAGGCATATGG - Intronic
1183937909 22:41274434-41274456 CAGGGCACACAGCATTGGCTAGG - Intronic
1184262509 22:43327248-43327270 CAGATCACACAGCAAATGCAAGG + Intronic
1184364996 22:44045126-44045148 CAGGTGCCCCTGCAGGGGCAGGG + Intronic
1184684688 22:46090795-46090817 CAGGCCCCACAGCAGGGCAATGG - Intronic
1184919607 22:47596441-47596463 CAGGCCCCACAGCAGTGCCAGGG - Intergenic
1185231805 22:49687940-49687962 AAGGTCACACAGCAGGGCTGGGG + Intergenic
950108908 3:10405944-10405966 TAGGTCACACAGCATGTTCATGG - Intronic
950109036 3:10406903-10406925 CAGATGACAAAGCAGGGGCTCGG - Intronic
950131361 3:10549096-10549118 CATGTCACACAGCTGGCACATGG - Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950153554 3:10706915-10706937 AAGGTCACACAGCAGGGGGCAGG - Intronic
950680846 3:14584112-14584134 CAGGTCACACAGTAGGTGAGGGG + Intergenic
950771847 3:15318046-15318068 CAGGTCACACAGCCAGGGAGTGG - Intronic
950863627 3:16171899-16171921 CAGGTTCCCCAGCAGAGGCAGGG + Intergenic
950956100 3:17054883-17054905 AAAGTCACACAGCAGGGACATGG - Intronic
951196470 3:19828616-19828638 CGGCACACCCAGCAGGGGCATGG - Intergenic
951541820 3:23789202-23789224 CTGGACACACAGGAGTGGCAGGG + Intergenic
952899775 3:38102329-38102351 CCTGTCACCCAGCAGGGGAAGGG - Intronic
953659572 3:44882315-44882337 CAGGTCACAGAGCAGTGCCCAGG + Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954710475 3:52502908-52502930 CAAGTCACACAGAACAGGCAAGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
955829468 3:62985890-62985912 TAGGTCACACAGCAGGTACTTGG + Intergenic
955957529 3:64305657-64305679 CAGGTCCCACAGTAGGAACAGGG - Intronic
956611266 3:71125883-71125905 CAGGTCACACAGCTAGCGAATGG - Intronic
957124100 3:76135191-76135213 TGGGTCACACAAGAGGGGCAGGG + Intronic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
959705993 3:109339311-109339333 CAGGTCACACAGCTAGTGAAGGG - Intergenic
960084474 3:113575904-113575926 CAGGGCACATTGGAGGGGCAGGG + Intronic
960294942 3:115931372-115931394 CAGGTCACTCAGCTGGGGGCAGG - Intronic
961391864 3:126557213-126557235 CAGGTCACGCAGCAGAGGATAGG - Intronic
961483076 3:127196528-127196550 CAGGTCGCACAGGAGGGGATGGG - Intronic
961538922 3:127587521-127587543 CAGGTCACACAGCAAGCACGTGG - Intronic
962344303 3:134608264-134608286 CAGTTCACATAGCAGGGAAAAGG - Intronic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
963116375 3:141733516-141733538 CAGGTCACACAGCAAGCAAAGGG - Intergenic
963254261 3:143129357-143129379 AAGGTCACACAGCTAGTGCATGG + Intergenic
964223175 3:154368976-154368998 ATGGGCGCACAGCAGGGGCAAGG + Intronic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
965572924 3:170189650-170189672 GAGGTCACAGAGCTGGTGCATGG - Intergenic
966329552 3:178795251-178795273 CAGGTGACGCAACTGGGGCAGGG + Intronic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967289663 3:187906597-187906619 CAGCACAGACAACAGGGGCAGGG + Intergenic
967866946 3:194198125-194198147 GAGGCCACACAGCAGGAGCTTGG - Intergenic
968382688 4:109185-109207 CAGAAAACACAGCAGGTGCAGGG - Intergenic
968563718 4:1298296-1298318 CAGGTCACAGGGATGGGGCAGGG - Intronic
968829829 4:2927405-2927427 CAAGCCACACATCAGGGCCAGGG - Intronic
968864276 4:3197858-3197880 CAGGCCACAGAGCACGTGCAGGG - Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969107158 4:4816147-4816169 CAGGTCCCTGAGCATGGGCAGGG - Intergenic
969530373 4:7727050-7727072 CAGGCCACACAGCCAGGGCAGGG - Intronic
969569518 4:8000441-8000463 AAGGTCACACAGCAAGGGACGGG + Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969671940 4:8594471-8594493 CAGGTCACACAGCAGAGTTGAGG - Intronic
970155907 4:13141635-13141657 CAGGTAAGACAGCATGTGCAGGG + Intergenic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974818174 4:67032980-67033002 CAGTGCACACACCAGGGGCTCGG + Intergenic
974968892 4:68801796-68801818 ATGGGCGCACAGCAGGGGCAAGG + Intergenic
975121765 4:70736451-70736473 CAGGTCACACAGCACAGGTGTGG - Intronic
975644906 4:76536584-76536606 CAGATAAGACAACAGGGGCATGG - Intronic
976864787 4:89711066-89711088 CAGGTCATATAGCAGTGCCATGG - Intergenic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
977890218 4:102301276-102301298 CAGGTCACACACAAGGGACCTGG - Intronic
979005656 4:115292619-115292641 CAGAACACAGAGCAGGGGAAGGG - Intergenic
979303106 4:119110092-119110114 AAGGTCACACAGCAAGGAGAGGG - Intergenic
980705586 4:136488804-136488826 CAGGTCACAAAGCAGGGTGGAGG + Intergenic
981634298 4:146858244-146858266 AAGGTCACACAGCTAGTGCATGG + Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982777755 4:159459317-159459339 CACGTCACATAGCAAGAGCAGGG - Intergenic
983967580 4:173831819-173831841 CAGGTCACAGAGCAAGAGCAGGG + Intergenic
985383595 4:189421588-189421610 CAGGTAACAGAGCAAGGGAATGG - Intergenic
985551210 5:534515-534537 GAGGTCACAGAGCAGTGGCCAGG - Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
985812462 5:2099704-2099726 CAAGTCACAAAGCTGGGGGATGG + Intergenic
987059224 5:14226101-14226123 GAGCTCACACAGGAGAGGCAAGG + Intronic
988166577 5:27597875-27597897 CAGGTCACACAGCCAGTACATGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991413893 5:66371609-66371631 CAGGTGAAACAGCAGTGGCCAGG - Intergenic
993037210 5:82770921-82770943 CAGGTCACAGTGCAAGGACAGGG - Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
996749064 5:126871126-126871148 GAGGTCACACAGCTGGGCGAGGG - Intronic
997088770 5:130831782-130831804 CAGGTAACAGCGCAGGTGCAAGG + Intergenic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
997625412 5:135327608-135327630 CAGGCCACACAGCAGGAACCTGG - Intronic
998445304 5:142193879-142193901 CAGGTCACAAAGTTGGGGCATGG + Intergenic
999172698 5:149608739-149608761 CAGGTTACACAACTGGGGAAGGG + Intronic
999201640 5:149820795-149820817 GAGGTGACACAGCAAGGGCCAGG - Intronic
999266682 5:150271136-150271158 CTAGTCACACAGCAATGGCAAGG + Intronic
999295915 5:150459320-150459342 CAGGTCACTCAGCTGGTTCAGGG + Intergenic
999309028 5:150539503-150539525 AAGGTCACACAGCCGAGGCAGGG - Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1001092215 5:168749852-168749874 CAGTTCACACAGCCAGGGCTTGG - Intronic
1001093115 5:168756202-168756224 CAGGTCACAGAGCATTGGAAGGG + Intronic
1001541531 5:172543043-172543065 CAGCTCACTCCGCAGGGACAGGG - Intergenic
1002039892 5:176505257-176505279 GAGGCCACAGAGCAGGGACAGGG + Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002472118 5:179441710-179441732 CATGTGACACAGTAGGGGAAGGG - Intergenic
1002802154 6:533771-533793 CAGGTCACCCTGCAGGGGGCTGG + Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003479604 6:6519022-6519044 CAGGTCAGCAAGCAGGGTCAGGG - Intergenic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004460409 6:15829857-15829879 CAGGTCACACAGCTAGGGACTGG - Intergenic
1005008367 6:21312408-21312430 CAGGCCAGACTGCAGGGGAATGG - Intergenic
1005149303 6:22730401-22730423 CGGTTCACACAGCAAGAGCAGGG - Intergenic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006440907 6:34053208-34053230 AAGGTCACACAGCAGGGAGGAGG + Intronic
1006515692 6:34544452-34544474 CAGCCCAAACAGCAGCGGCATGG - Exonic
1006520574 6:34568789-34568811 GAAGTCACACAGCAGGGTCAGGG + Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007262498 6:40573610-40573632 CAGGTCACAGAGCAAATGCATGG - Intronic
1007294955 6:40814582-40814604 CTTGTGACCCAGCAGGGGCATGG + Intergenic
1007483811 6:42166992-42167014 CAGGTCACACAGCATACACAGGG - Intronic
1007724719 6:43908256-43908278 AAGGCCACACAGCAGAGCCAGGG - Intergenic
1008132673 6:47736807-47736829 AAGGGCACACAGCAGGGAAATGG - Intergenic
1008417196 6:51255626-51255648 GAGGTGGCACAGCAGAGGCATGG - Intergenic
1008484222 6:52017604-52017626 CAGGCCACACAGGAAGGCCAAGG + Exonic
1009567250 6:65324720-65324742 CAAGTCACACAGCAGAGCCAGGG - Intronic
1011744927 6:90400239-90400261 CAGGGCAGTCCGCAGGGGCATGG - Intergenic
1012100766 6:95083740-95083762 CAGGTCACACAGCAGCACCTGGG - Intergenic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1013900124 6:115145371-115145393 TAGGTCACACAGCTGGTGAATGG - Intergenic
1014383252 6:120770555-120770577 CAGGTCCCTCAGCAGGGAAATGG - Intergenic
1016356451 6:143224015-143224037 CACGTAACACAGAAGAGGCAGGG - Intronic
1016773224 6:147875552-147875574 CAGGCCACAGACCAGGGGCTGGG - Intergenic
1017153666 6:151303955-151303977 CAGGTCACACAGCTCAGGAATGG - Intronic
1018068178 6:160138163-160138185 AAGGTCACACAGCCAGGACATGG - Intronic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018430235 6:163716399-163716421 CAGGTCACAGAGCTGGTGAATGG + Intergenic
1018545369 6:164929810-164929832 AAGGTCACTCAGCAGCGGAAAGG - Intergenic
1018810801 6:167296486-167296508 CAGGTGCCTCCGCAGGGGCAGGG + Intronic
1018812370 6:167307252-167307274 CGGGTCACGCAGCAGGTGTATGG + Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019306779 7:339249-339271 CAGGGCCCACAGTAGCGGCAAGG - Intergenic
1019388432 7:771707-771729 CAGATAACACAGCAGGGTCCAGG + Intronic
1019405335 7:880577-880599 GAGGTCACCTGGCAGGGGCACGG + Intronic
1019497583 7:1347657-1347679 CAGGTTACACAGCAGGGTGCAGG - Intergenic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019539339 7:1544768-1544790 GAGGTCACAGAGCAGGGACTTGG - Exonic
1019567705 7:1692740-1692762 TAGGTCACACAGCAGAGTCAGGG - Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020264832 7:6553409-6553431 AAGGTCACCCAGCTGGGGAATGG + Intergenic
1021994277 7:26164724-26164746 CAGGACATATAGCATGGGCAAGG - Intronic
1022364225 7:29695342-29695364 CAGGCCTGACAGCAGGGACACGG + Intergenic
1022495144 7:30848383-30848405 TGGGCCACACAGCAGGGGAAGGG + Intronic
1022697139 7:32718390-32718412 CAGGCCTGACAGCAGGGACACGG - Intergenic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023822214 7:43986562-43986584 CCGGTCAAACAGTAGGGGCAGGG - Intergenic
1024185723 7:46946097-46946119 GAGGTCACAGGGAAGGGGCAGGG + Intergenic
1024996939 7:55279352-55279374 CAGGTCTCAGAGCAGGGCCCAGG + Intergenic
1025206166 7:56994421-56994443 CAAGTGTCTCAGCAGGGGCAGGG + Intergenic
1025854655 7:65266690-65266712 CAGATCACACACCATGGGCATGG - Intergenic
1026228273 7:68461682-68461704 AAAGTCATACAGCAGAGGCAGGG + Intergenic
1026836927 7:73645814-73645836 AAGGTCACACAGCCTGGGAACGG - Intergenic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1027266290 7:76496874-76496896 CAGATCAGCCAGGAGGGGCATGG + Intronic
1027317670 7:76994992-76995014 CAGATCAGCCAGGAGGGGCATGG + Intergenic
1029610366 7:101623294-101623316 GAGGTCACACAGCAAGCACAGGG + Intronic
1029750480 7:102539976-102539998 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029768432 7:102639084-102639106 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1030580820 7:111352706-111352728 AAGTTCACACAGCAGCCGCATGG + Intronic
1031482904 7:122300161-122300183 CAGGGGACACTGCAGGGGCGCGG - Intergenic
1031483252 7:122302461-122302483 CAGGTCCCACAACAAGTGCAGGG + Intronic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1032578439 7:133081246-133081268 CAGGTCACAGAGGAGGCGCCTGG + Intronic
1032615117 7:133460297-133460319 CAGGCCACACAGCAGGTGAGCGG - Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033847756 7:145455036-145455058 AAAGTAACACAGTAGGGGCAGGG + Intergenic
1034078705 7:148257111-148257133 CAGGTCACAGCACAGGGGCAAGG + Intronic
1034267698 7:149789225-149789247 GCGGTCACAGAGCAGGGCCAGGG - Intergenic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1034614997 7:152408496-152408518 CAGGCCACACAGCAGGTGAGCGG + Intronic
1034883941 7:154783302-154783324 CAGCTCACACAGGACGGGCAGGG + Intronic
1035282357 7:157786018-157786040 GAGGCCAAACAGCAGGGGCCTGG - Intronic
1035352949 7:158259262-158259284 CAGGCCACAGAGAAGGGCCATGG + Intronic
1035651981 8:1273393-1273415 CAGGTCACACAGCTGGCTTATGG + Intergenic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036183537 8:6605101-6605123 CTGGTCCCACAGCAGGTGCTTGG + Intronic
1036631193 8:10516826-10516848 AAGGTCACATAGCAGGTACATGG + Intergenic
1036663298 8:10722197-10722219 CAGGACACACTGTGGGGGCATGG - Intergenic
1037752749 8:21693299-21693321 CAGGACAGACAGCACGGTCAAGG + Exonic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038667362 8:29550666-29550688 CAGGACACAGAACAGGTGCAAGG - Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039447780 8:37646456-37646478 CATGTCACACAGCCAGAGCAGGG + Intergenic
1039742409 8:40394711-40394733 CAGGTCACAAAGCAGAAGTAGGG + Intergenic
1041327939 8:56689097-56689119 CATGTCAGTGAGCAGGGGCAGGG + Intergenic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1042452687 8:68967216-68967238 CAGGTAACACAGCTAGGGCCAGG + Intergenic
1042461013 8:69068667-69068689 TAGATATCACAGCAGGGGCATGG - Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1044064636 8:87684482-87684504 AAGGACACACATGAGGGGCATGG + Intergenic
1044499325 8:92932962-92932984 CAGGTCCCAGGGCAGGAGCAGGG - Intronic
1045331099 8:101156327-101156349 AAGGTCACACAGAAGGCACATGG - Intergenic
1045414202 8:101950520-101950542 CAAATCACACAGCAGAGGGAGGG - Intronic
1047538163 8:125738194-125738216 GAGATCACACAGCAGGAGTATGG - Intergenic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1048321905 8:133406575-133406597 GAGGTCACACAGCAGGGAAGAGG - Intergenic
1048780148 8:137990929-137990951 ATGGGCACACGGCAGGGGCAAGG + Intergenic
1048866744 8:138767043-138767065 AAGGTCACACAGCTGGAGCGTGG - Intronic
1049224347 8:141442509-141442531 CCTGTCACACAGCCTGGGCAAGG + Intergenic
1049229808 8:141476054-141476076 CAGGGCATCCAGCAGTGGCAGGG + Intergenic
1049357157 8:142194599-142194621 CCCGTCACACAGCAGTGGCCCGG - Intergenic
1049379274 8:142303936-142303958 CAGGCCCCTCGGCAGGGGCACGG + Intronic
1049427204 8:142542781-142542803 CAGCACACCCAGCAGGGCCAGGG - Intronic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1049883726 9:14629-14651 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1049899731 9:147750-147772 CAGGTCACAGACAAGGGGCACGG + Intronic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1052565426 9:30143846-30143868 CAGGTTAGACAGCAGGGATATGG + Intergenic
1053217525 9:36284635-36284657 CAGTTCATAAAGCAGTGGCATGG - Intronic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053742781 9:41158038-41158060 CAGGTCACAAACAAGGGGCACGG + Intronic
1054348058 9:63987879-63987901 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054445787 9:65314224-65314246 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054484482 9:65707281-65707303 CAGGTCACAAACAAGGGGCACGG - Intronic
1054685560 9:68273260-68273282 CAGGTCACAAACAAGGGGCATGG - Intronic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054754061 9:68939235-68939257 CAGGTCACACATCATTGGGAAGG - Intronic
1054777288 9:69134360-69134382 CAAGTCCCACAGCAGGTGCAGGG + Intronic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056795765 9:89657906-89657928 GCGGTGACACAGCATGGGCATGG - Intergenic
1056823643 9:89861554-89861576 CAGGACAGAGAACAGGGGCAGGG - Intergenic
1057537329 9:95925106-95925128 CAGGTCAGCCTGCAGGTGCAAGG + Intronic
1058350110 9:104011074-104011096 CAGGCCAGACTGCAGTGGCACGG - Intergenic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1058886933 9:109328882-109328904 CACCTCACCCAGCTGGGGCATGG + Intergenic
1058894227 9:109385995-109386017 CAGGACTCACAGCAGGCGTATGG - Intronic
1059050439 9:110918977-110918999 CTGCTCACACACCAGGGGAAGGG - Intronic
1059362132 9:113753168-113753190 AAGGTCACACAGCAGGTTAACGG + Intergenic
1059444778 9:114331406-114331428 CTGGGCACGCAGCAGGGGCTGGG + Intronic
1059458120 9:114412516-114412538 AAGGTCACACAGCAAGGACAGGG + Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1060145227 9:121247123-121247145 AAAGTCAGCCAGCAGGGGCAAGG + Intronic
1060403241 9:123360466-123360488 CAGGCCAGACAGGAGAGGCAAGG - Intronic
1060521309 9:124295559-124295581 CAGGTCACACAGCAGGCGGCAGG - Intronic
1060664892 9:125427044-125427066 CAGGGCACACAGCTAAGGCACGG - Intergenic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060890698 9:127186435-127186457 CATGTCCCGCAGCAGGGGCAAGG - Intronic
1060978014 9:127776739-127776761 AGGGTCACACAGCAAGGCCATGG + Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061039310 9:128130717-128130739 CAGGACAGAGAACAGGGGCAGGG + Intergenic
1061245936 9:129401383-129401405 CAGGGCCCAGAGCAGGGGCTGGG - Intergenic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061548794 9:131320421-131320443 CAGGTCTCATGGCTGGGGCAGGG - Intergenic
1061794060 9:133073800-133073822 CAGGCCACACAGCTGGGGAGCGG + Intronic
1062026531 9:134343164-134343186 CAGGTCACACAGCATGTAAAAGG - Intronic
1062114054 9:134798084-134798106 CAGGTGACACAGCCGGTGCCAGG - Intronic
1062340364 9:136091341-136091363 AAGGTCACACAGCCTGGGCTGGG + Intronic
1062352934 9:136148037-136148059 AAGGCCACACAGCAGGTGGAGGG + Intergenic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1062472945 9:136714135-136714157 CAGGATCCACAGCAGGGTCAGGG + Intronic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1062672939 9:137722604-137722626 CAGAGCACACCGCAGGTGCAGGG - Intronic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1186285316 X:8037617-8037639 CAGGTTCTACTGCAGGGGCAAGG - Intergenic
1187259090 X:17668730-17668752 CAAGTAACACAGCAGGGGAGTGG + Intronic
1187501293 X:19841176-19841198 TGGGTCACAGAGCAGGGCCACGG - Intronic
1188440965 X:30215247-30215269 CAGGCCTGACAGCAGCGGCAGGG - Intergenic
1188445008 X:30246879-30246901 CAGGCCTGACAGCAGCGGCAGGG - Intronic
1192156609 X:68751466-68751488 CAGTTCACACAGCAGTTGCTGGG - Intergenic
1192833806 X:74778302-74778324 CAAGCCCCACAGAAGGGGCAAGG - Intronic
1193135956 X:77970736-77970758 CAGGCCACACCGAAGGGGAAAGG + Intronic
1193242452 X:79187029-79187051 CAGGGCATATAGCAGGGCCAGGG - Intergenic
1193514317 X:82445471-82445493 CACGTCACACGGCAAGTGCAAGG + Intergenic
1193763756 X:85499496-85499518 CAGGTCAGACAGTAGCTGCAAGG + Intergenic
1195988927 X:110663484-110663506 AAAGTCACACAGCAAGGACAGGG + Intergenic
1196309620 X:114148165-114148187 CAAGACACCCAGCAGCGGCATGG + Intergenic
1197155641 X:123266965-123266987 GAGGACACACAGCAGGGCTAAGG - Intronic
1198618272 X:138481243-138481265 CAGGGCTCATAGCAGGGTCAGGG - Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200402088 X:156025530-156025552 GAGGCCACACAGCTGGGGCGGGG + Intergenic