ID: 1002181563

View in Genome Browser
Species Human (GRCh38)
Location 5:177433543-177433565
Sequence ACCTGTGGCCCGCACCTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002181563_1002181567 13 Left 1002181563 5:177433543-177433565 CCTGCCAGGTGCGGGCCACAGGT 0: 1
1: 1
2: 2
3: 24
4: 212
Right 1002181567 5:177433579-177433601 GCAAGAAGCTAGAGAAAAAGCGG 0: 1
1: 0
2: 7
3: 49
4: 540
1002181563_1002181569 30 Left 1002181563 5:177433543-177433565 CCTGCCAGGTGCGGGCCACAGGT 0: 1
1: 1
2: 2
3: 24
4: 212
Right 1002181569 5:177433596-177433618 AAGCGGATCAAGAAGCGGAAAGG 0: 1
1: 1
2: 0
3: 7
4: 91
1002181563_1002181568 25 Left 1002181563 5:177433543-177433565 CCTGCCAGGTGCGGGCCACAGGT 0: 1
1: 1
2: 2
3: 24
4: 212
Right 1002181568 5:177433591-177433613 AGAAAAAGCGGATCAAGAAGCGG 0: 1
1: 1
2: 0
3: 30
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002181563 Original CRISPR ACCTGTGGCCCGCACCTGGC AGG (reversed) Exonic
900361185 1:2289837-2289859 CCCTCTGGGCAGCACCTGGCTGG + Intronic
900600040 1:3498981-3499003 ACCTGTGCCCCTCTCCAGGCAGG - Intronic
900633170 1:3649564-3649586 TCCTGGGTCCCGCACCTGCCCGG + Intronic
900633230 1:3649730-3649752 TCCTGGGTCCCGCACCTGTCTGG + Intronic
902920216 1:19661589-19661611 GCATGAGGCCCGCACCTGGCTGG - Intergenic
905629517 1:39510937-39510959 CCCTGAGCCCTGCACCTGGCTGG - Intronic
905668243 1:39775253-39775275 CCCTGAGCCCCGCAGCTGGCTGG + Intronic
906654406 1:47537270-47537292 ACCTGAGTGCCACACCTGGCTGG + Intergenic
907829047 1:58046788-58046810 ACCAGTGGCTGGCACATGGCAGG - Intronic
911231221 1:95363455-95363477 CCATGTGGCCCACACCTGGCAGG - Intergenic
911270739 1:95797973-95797995 AGCTGTGGCTGGCATCTGGCAGG + Intergenic
912478752 1:109961546-109961568 ACCAGTGGTGAGCACCTGGCAGG + Intergenic
916052598 1:161046995-161047017 ACCTGTGGCCCCAGCCTGGCTGG + Exonic
917584895 1:176416557-176416579 AGCTCTGGCTGGCACCTGGCAGG - Intergenic
918360308 1:183750953-183750975 AGCTCTGGCTGGCACCTGGCAGG - Intronic
923003227 1:230024701-230024723 AGCTGTGGTCCTCACCTGGAAGG - Intergenic
923066882 1:230526656-230526678 AGCTCTGGCTGGCACCTGGCGGG - Intergenic
924382045 1:243474404-243474426 GCCTGGAGCCCGCACCTGGAGGG - Intronic
1063389744 10:5641531-5641553 AGCTGTGGCCGACACCTGCCCGG - Intronic
1063482360 10:6386737-6386759 AGCAGTGGCCGGCACATGGCAGG - Intergenic
1063963723 10:11328474-11328496 GCCTGTTGGCCTCACCTGGCTGG + Intronic
1067947696 10:50700811-50700833 ACCTGTGGCCAGCACGGGGCTGG - Intergenic
1069325876 10:67230992-67231014 GACTGTGTCCCGCACCTGGCTGG + Intronic
1070327360 10:75397328-75397350 ACCTGTGTCCCGGGCCTGGGGGG - Intergenic
1070883012 10:79865804-79865826 ACCTGTGGCCAGCACAGGGCTGG - Intergenic
1071649580 10:87382119-87382141 ACCTGTGGCCAGCACAGGGCTGG - Intergenic
1073302445 10:102479394-102479416 TGCTGTGGCCCACACCTGGCAGG + Exonic
1074163031 10:110849754-110849776 ACCTGAGGCCAGCACCAGGCAGG - Intergenic
1075088812 10:119431394-119431416 ACCCGTGGCCCGAACCTGGCAGG - Exonic
1076607036 10:131695817-131695839 CCCTGAGGCCCGCACGTTGCAGG - Intergenic
1076675311 10:132144467-132144489 CCCTCTGGCCGGCACCTGGCAGG + Intronic
1076723495 10:132402951-132402973 TCCTGGCGCCAGCACCTGGCTGG + Intronic
1076793006 10:132786591-132786613 TCCTGTGGCCCCGACCTGCCCGG - Intergenic
1077021056 11:417336-417358 ACCTGGGGCTCGCGCCGGGCGGG + Intronic
1077326778 11:1967404-1967426 AGCTGAGGCCCGGGCCTGGCGGG - Intronic
1077564723 11:3290306-3290328 ACTTGTGGCCCGCACCTGTGCGG - Intergenic
1077723709 11:4652494-4652516 AACTGTGACCAGCACCAGGCAGG - Exonic
1079077628 11:17393759-17393781 AGCTGTTGCCCCCACTTGGCAGG - Exonic
1081766932 11:45617809-45617831 ACCTGTGCCTGGCACATGGCAGG + Intergenic
1082830635 11:57614464-57614486 CTCTGTGGCCCGCACCCTGCTGG + Exonic
1084540061 11:69780844-69780866 GCCTGTCGCCCAGACCTGGCTGG - Intergenic
1084843497 11:71878788-71878810 CCCTGTTGCCCCCACCGGGCTGG - Intronic
1089110676 11:116053395-116053417 TTTTGTGGCCAGCACCTGGCAGG + Intergenic
1089171871 11:116517688-116517710 CCCTGTGGCTGGCTCCTGGCCGG - Intergenic
1202809759 11_KI270721v1_random:22584-22606 AGCTGAGGCCCGGGCCTGGCGGG - Intergenic
1096312422 12:50532925-50532947 TCCTCTGGCCCTCACCGGGCTGG + Intronic
1096674010 12:53216915-53216937 ACCTGTTGCCCAAACCTGGAGGG + Intronic
1096779544 12:53984280-53984302 AGCTGTGGCCTGGGCCTGGCAGG - Intergenic
1097040708 12:56154402-56154424 AGCTGTTGCCTGCCCCTGGCTGG + Intronic
1101251476 12:102939899-102939921 ATCTGTGGCCAGCACTTGACTGG + Intronic
1101745033 12:107533354-107533376 TCCTGTGGGCAGCACCTAGCTGG - Intronic
1102825358 12:115943953-115943975 ACCTCTGGCTCTCACCTGGCAGG - Intergenic
1104687161 12:130793966-130793988 TCCTGTGCCCCGGGCCTGGCTGG - Intronic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105410503 13:20167835-20167857 ACCTGGTGGCCGCACCTGCCAGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1109527012 13:63588928-63588950 ACCTCTGCCTCGCACATGGCTGG + Intergenic
1110631029 13:77708509-77708531 AGCTCTGGCTCGCATCTGGCAGG + Intronic
1114555623 14:23560655-23560677 ACCTGAGGCCCGGACTTGGGAGG + Intronic
1118257478 14:64217658-64217680 GCCTGTGTTCCTCACCTGGCCGG + Intronic
1119618100 14:76111944-76111966 ACCTGGGTCCTGCACCTGGCAGG - Intergenic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1122232904 14:100315976-100315998 ACCTGTGGCCCCAGCCTGGCTGG - Intergenic
1122321738 14:100859614-100859636 AGCTGCGTCCCGAACCTGGCAGG - Intergenic
1122627034 14:103090089-103090111 AGCTGAGGCCCTCACCTGGAAGG - Intergenic
1122924371 14:104892866-104892888 ACCTCTGGCCAGCAGCTGCCTGG + Intronic
1122987388 14:105218807-105218829 GCCTGTGGCCAGCACGGGGCAGG + Intronic
1128074902 15:64819947-64819969 AGCTGTGGCCTGGAGCTGGCGGG + Exonic
1129495504 15:75976721-75976743 ACCTCTGGCTGGCATCTGGCGGG - Intronic
1129670601 15:77605801-77605823 ACCACTGGCTGGCACCTGGCTGG - Intergenic
1130274360 15:82468853-82468875 ACCTGTGCCCAGCCCCTGCCAGG + Intergenic
1130466706 15:84196227-84196249 ACCTGTGCCCAGCCCCTGCCAGG + Intergenic
1130497558 15:84477309-84477331 ACCTGTGCCCAGCCCCTGCCAGG - Intergenic
1130589002 15:85200820-85200842 ACCTGTGCCCAGCCCCTGCCAGG + Intergenic
1130735657 15:86545837-86545859 ACCAGTGATCCGCACATGGCTGG + Intronic
1130994155 15:88894955-88894977 GCCTCTGGACCGCAGCTGGCCGG - Intronic
1131251011 15:90830033-90830055 ACCTGTGGCCCCCAGCAGGGTGG + Intergenic
1131387402 15:92018703-92018725 ACCTGTGGGCTGCACCTGAGTGG + Intronic
1132241966 15:100265142-100265164 GCCTGTGGTCGGCACCTGGCAGG - Intronic
1132653426 16:1031621-1031643 CCCTGAGTCCAGCACCTGGCCGG - Intergenic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132728648 16:1349884-1349906 GCCTGTGGCCAGCACCCGGTAGG - Exonic
1133020114 16:2963481-2963503 AGCCGTGCCCCCCACCTGGCGGG - Intergenic
1141461678 16:84181649-84181671 CCCTGTAGCCCTCACCTGCCCGG - Exonic
1142229767 16:88894802-88894824 ACCTGTGGCTGAGACCTGGCGGG + Intronic
1142292300 16:89198749-89198771 ACCTGTGGCCAGCAGCCAGCAGG + Exonic
1142502218 17:339507-339529 GCCAGTGGCGGGCACCTGGCAGG - Intronic
1143030988 17:3966976-3966998 AACCGGGGCCCTCACCTGGCAGG + Intergenic
1143110869 17:4552110-4552132 ACGCGTCGCCCGCACCTGGCTGG + Exonic
1145981051 17:29011811-29011833 TCCTGTGGGCTGCCCCTGGCAGG + Intronic
1146637425 17:34516861-34516883 CCCTGGGGCTGGCACCTGGCAGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150562439 17:66304547-66304569 ACCTGTGCCACACAGCTGGCTGG - Intronic
1151049862 17:70965344-70965366 ACCTGTAGTCCTCACTTGGCAGG + Intergenic
1151967598 17:77439537-77439559 CCCTGTGGCCAGCAGCTTGCAGG + Intronic
1152072807 17:78142369-78142391 ACCAGTGACCAGCTCCTGGCTGG + Exonic
1152181425 17:78824144-78824166 ACCTCTGGTGCGCTCCTGGCTGG - Intronic
1152244927 17:79180493-79180515 ACCTGCAGCCCCCACCTGGGAGG + Intronic
1152925282 17:83084802-83084824 ACCTGTGGCCGGCAGCGGGTGGG + Intronic
1154297337 18:13162299-13162321 ACCTGGGTCCCCCACCTGTCGGG + Intergenic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1154999260 18:21670652-21670674 ACCTGTGACCTTCACCTGCCTGG + Intronic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1157483949 18:48073763-48073785 TCCTGTGGCTGGCAGCTGGCAGG + Intronic
1160143621 18:76347422-76347444 CCCTGAGGCTCGCACCTGCCCGG + Intergenic
1160739456 19:679294-679316 GCATGTGGGCCGCACCTGGGCGG - Intronic
1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG + Intergenic
1162116030 19:8430015-8430037 AAATGTGCCCAGCACCTGGCAGG + Intronic
1162873066 19:13600329-13600351 CTCTGTGGCCGGCACCTGGGAGG - Intronic
1163692459 19:18745136-18745158 ACCTGGGGCTGGCACCAGGCTGG - Intronic
1164425696 19:28139452-28139474 ACCTGTGGCTGGAACATGGCTGG - Intergenic
1164759635 19:30719400-30719422 CCCTGTGGGCTGCACCCGGCTGG + Intergenic
1165072238 19:33262061-33262083 AGCTGAGGCCTGTACCTGGCAGG + Intergenic
1165692449 19:37874095-37874117 ACTTGTGGCCAGCACTTGGGAGG + Intergenic
1166765986 19:45252174-45252196 GCCTGTGGGCAGCCCCTGGCAGG + Intronic
1166947948 19:46408673-46408695 AGCTGTGGACCTCACCTGGAGGG - Intergenic
1167974024 19:53209691-53209713 AGCTCTGGCTGGCACCTGGCGGG - Intergenic
925328214 2:3039038-3039060 CCCTGTGGGCCTCACCTGGATGG - Intergenic
925751237 2:7091731-7091753 ACCTGTGGCCAGCTCCAGGCAGG - Intergenic
926384235 2:12320298-12320320 CCCTGTGACTGGCACCTGGCAGG + Intergenic
927255889 2:21040566-21040588 TGCTGTGGCCGGCACATGGCGGG - Intronic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
930216932 2:48707286-48707308 AGCTCTGGCCAGCATCTGGCAGG - Intronic
933355710 2:81206754-81206776 AGCTCTGGCTGGCACCTGGCAGG + Intergenic
933764412 2:85697154-85697176 ACCTGGGTCCAGGACCTGGCTGG - Intronic
934312220 2:91877856-91877878 AACTGCGGCCCGCAGCGGGCTGG - Intergenic
936172316 2:110186655-110186677 TCCTTTGGCCCATACCTGGCAGG - Intronic
938373296 2:130787464-130787486 AACAGTGGCCTGCACCTGGGAGG - Intergenic
940114496 2:150192922-150192944 AGCTCTGGCCGGCATCTGGCGGG + Intergenic
942576904 2:177373591-177373613 AGCTCTGGCCAGCATCTGGCAGG - Intronic
944608015 2:201370372-201370394 AGCTCTGGCTGGCACCTGGCAGG + Intergenic
944801190 2:203239206-203239228 CCCTGCGGCCCGCAGCGGGCAGG - Intronic
946146723 2:217736689-217736711 CCATGTGTCCAGCACCTGGCCGG - Intronic
948197744 2:236107782-236107804 GCCTGGGGCCTGCACCTGCCGGG + Intronic
948437193 2:237961672-237961694 ACCTGGGGCCCTGACCTGGCAGG + Intergenic
948691952 2:239711704-239711726 ATCTGTGTCCTGCACCTGGGAGG + Intergenic
1173111447 20:40194295-40194317 ACCTGTGTTCAGCACCTGGATGG + Intergenic
1173405185 20:42758329-42758351 ACCTGTGCCCCTCTCCTGACAGG - Intronic
1175887072 20:62298182-62298204 TCCTGTCGCCCACACCTTGCAGG + Intergenic
1175969325 20:62675853-62675875 CCCTGTGGCCGGCACCTTCCTGG - Intronic
1176039686 20:63058866-63058888 ACCTGTGGCCCTGAACTGGGGGG - Intergenic
1176111095 20:63411156-63411178 GCCTGTGCCGGGCACCTGGCAGG + Intronic
1176230450 20:64030102-64030124 TGCTGTGCCCCACACCTGGCGGG - Intronic
1176965636 21:15208763-15208785 GCCTGTGGTCCGTGCCTGGCTGG - Intergenic
1178518179 21:33266267-33266289 GCCTGTGCCCCGCGCCTCGCGGG + Intronic
1179587650 21:42383776-42383798 ACCTGTCGGCCTCACCTGTCAGG - Intronic
1179885858 21:44314033-44314055 ACCTGCGGCCCCCAGCAGGCTGG - Intronic
1180014269 21:45072630-45072652 ACATGTGGCCCGGATCTGCCCGG + Intergenic
1180952911 22:19728796-19728818 CCATGTGGCCCCCACCTGTCTGG + Intergenic
1183094905 22:35546142-35546164 ACCTGTGCTCTGCATCTGGCGGG - Intronic
1184379274 22:44134904-44134926 ACCTGGGCCCAGCACCTGGTGGG + Intronic
1185030550 22:48440782-48440804 ACCTGAGGCACACACCAGGCTGG + Intergenic
950425639 3:12923513-12923535 AAGTGTGGCCAGCACATGGCAGG - Intronic
950505765 3:13393562-13393584 GCCAGTGGCCAGCAGCTGGCAGG - Intronic
952338289 3:32423824-32423846 ATCTGTGACCTGCACCTGGGGGG - Intronic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
955071770 3:55577709-55577731 ACCTGTGGCCACCACCTAGCAGG - Intronic
961327310 3:126116740-126116762 ACCTGTGGTCTGGCCCTGGCTGG + Intronic
966832761 3:184024362-184024384 GCATGTGGCCCGCAGCTGTCAGG + Intergenic
968300192 3:197607032-197607054 GACTGTGGCCCTCACCTGACAGG + Intergenic
968481597 4:835420-835442 AGGTGTGGCCGGCACCTAGCGGG + Intergenic
968506480 4:973443-973465 GCCCGGGGCCCGCGCCTGGCTGG - Exonic
968506705 4:974176-974198 ACCCGTGGCGCGCACGAGGCAGG - Intronic
968841929 4:3013695-3013717 TCCTGTGGCTCGCACTTGACAGG - Exonic
968901023 4:3431883-3431905 ACCTGTAGCCTGGACCTCGCCGG + Intronic
969702161 4:8773660-8773682 ACCTCTGGCCTCCACCAGGCGGG - Intergenic
972204887 4:36759804-36759826 ACCTGTCGTCCGCAGCAGGCTGG - Intergenic
975424896 4:74214600-74214622 AGCTGTGGCTGGCATCTGGCGGG - Intronic
978664373 4:111164781-111164803 AGCTGTGGCTGGCATCTGGCAGG + Intergenic
985655221 5:1128193-1128215 ACCTGTGGTCTCAACCTGGCGGG + Intergenic
985786324 5:1897128-1897150 CCCTGAGGCCCGCACAAGGCCGG - Intergenic
991026589 5:62037038-62037060 ACCTCTGGCTGGCATCTGGCAGG - Intergenic
997457340 5:134027066-134027088 ACCCCTGGCCACCACCTGGCAGG - Intergenic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
998780065 5:145646909-145646931 AGCTCTGGCCGGCATCTGGCAGG - Intronic
999468740 5:151831896-151831918 AGCTCTGGCTGGCACCTGGCAGG + Intronic
1001398594 5:171433514-171433536 TCCTGAGGCCCACACCTGGTGGG - Intronic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002197343 5:177508631-177508653 AGCAGAGGCCCGCTCCTGGCTGG - Intronic
1002473480 5:179451307-179451329 AGCTGTGGGCAGCGCCTGGCTGG - Intergenic
1002480615 5:179498402-179498424 AGCTGTGGGCAGCGCCTGGCTGG + Intergenic
1002632507 5:180590979-180591001 CCCGGGGGCTCGCACCTGGCAGG - Intronic
1004151426 6:13123804-13123826 ACCTGTGGCCCGGGCCAGGTAGG + Intronic
1006063290 6:31441876-31441898 CCCTGTTCCCCGCACCTGGACGG + Intergenic
1007082464 6:39117561-39117583 ACCTTAGGCCCGCATCTTGCAGG + Intergenic
1007270053 6:40629499-40629521 ACCTATGGCCCTCACCTGCAGGG + Intergenic
1007276003 6:40674337-40674359 ATATGTGCCCAGCACCTGGCAGG + Intergenic
1014113461 6:117646328-117646350 AGCTCTGGCCGGCATCTGGCGGG + Intergenic
1017726925 6:157282733-157282755 ACCTGTGGACCGCACCTTGGGGG + Intergenic
1019522570 7:1467411-1467433 GCCTGCGGCGGGCACCTGGCAGG - Intergenic
1019567844 7:1693463-1693485 CCCTGCGGCACGCACCTGTCTGG - Exonic
1019665732 7:2251491-2251513 TCCTGTGGACGGGACCTGGCAGG - Intergenic
1023765944 7:43510884-43510906 TACTGTGGCCCACACTTGGCTGG + Intronic
1023864709 7:44233234-44233256 ACCTGTGCCCCCCACCACGCTGG - Intronic
1025161093 7:56661482-56661504 ACCTGTGGGCAGAACCAGGCAGG - Intergenic
1025750113 7:64286603-64286625 ACCTGTGGGCAGAACCAGGCAGG + Intergenic
1026457193 7:70583091-70583113 ACCTTGGGGCCGCCCCTGGCTGG + Intronic
1029487586 7:100852865-100852887 AGCTGTGGGGTGCACCTGGCCGG + Intronic
1032078805 7:128848596-128848618 GCCGCTGGCCCGCACCTTGCTGG - Exonic
1033541044 7:142356340-142356362 ACCCATGCCCTGCACCTGGCAGG - Intergenic
1033552274 7:142458259-142458281 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033554538 7:142477208-142477230 TCCTGTGCCCTGCACCTGGTGGG - Intergenic
1033556815 7:142495313-142495335 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033559163 7:142514752-142514774 TCCTGTGCCCTACACCTGGCAGG - Intergenic
1034466700 7:151233979-151234001 CCCTGGGGCACCCACCTGGCAGG + Exonic
1034937753 7:155210630-155210652 AACTGTGGCCCCACCCTGGCCGG - Intergenic
1035435533 7:158856643-158856665 ACCTGTGCCCCGCACCCTTCGGG - Exonic
1036834442 8:12049268-12049290 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1036856285 8:12295832-12295854 CCCTGTTGCCCCCACCGGGCTGG + Intergenic
1038804338 8:30776618-30776640 TCCTGAGGGCCGCACCTCGCGGG - Intronic
1041323231 8:56636707-56636729 ACCTCTGGCTGGCATCTGGCGGG - Intergenic
1042195664 8:66229281-66229303 AGCTCTGGCCGGCATCTGGCAGG + Intergenic
1047020339 8:120769036-120769058 ACCTGTTTGCCTCACCTGGCAGG + Intronic
1047536548 8:125725340-125725362 TCCTGTGGGCTGCACCTGCCAGG - Intergenic
1048977290 8:139680170-139680192 ACCTGAAGCCCGCGCTTGGCTGG - Intronic
1049163967 8:141115513-141115535 ACCTGCACCCTGCACCTGGCTGG + Intergenic
1049328526 8:142037621-142037643 ACATGAGGCCAGCACATGGCAGG + Intergenic
1049469782 8:142770158-142770180 GCCTGTGGCCGTCACCTGCCTGG - Intronic
1052241456 9:26278167-26278189 AGCTCTGGCCAGCACCTGGCAGG + Intergenic
1052916767 9:33929078-33929100 TCCTTTGGCCCGCTCCTGGTGGG - Intronic
1053353908 9:37430863-37430885 AGCAGTGGCCCCCACCCGGCGGG + Intronic
1055447980 9:76402055-76402077 AACTGTAGCCCTCATCTGGCTGG - Intergenic
1058161906 9:101579181-101579203 ACCTGTGGCACTCACCTGGCTGG + Exonic
1058619122 9:106864217-106864239 ACCTGCGCCCCCCACCCGGCCGG - Intronic
1059079514 9:111233586-111233608 AACTGTGCCCAGCACCTGGGAGG + Intergenic
1059974296 9:119699266-119699288 GCCTGTGGGCCAGACCTGGCTGG - Intergenic
1060739426 9:126088539-126088561 CCCTGTGGCAGGCACTTGGCAGG - Intergenic
1061682686 9:132250767-132250789 AGCTGTGGCCAGCACGTGGTGGG + Intergenic
1061922353 9:133789036-133789058 GCCTGTGGCGGGCACCAGGCTGG - Intronic
1062463286 9:136670801-136670823 ACCTCTGGCCAGCGCCAGGCAGG + Intronic
1062579427 9:137222808-137222830 CCCTGAGGACCGCACCTGCCCGG + Intergenic
1062697431 9:137882640-137882662 AGCTGTGGCCTGCACATGGTGGG + Intronic
1062715785 9:138009468-138009490 ACCTGTGGCCAGCACATGCTGGG - Intronic
1189350586 X:40272850-40272872 CCCTGTTTCCCGCACCTGGTGGG + Intergenic
1194424177 X:93716723-93716745 ACCTGCTGCCAGCACCTGGATGG + Intergenic
1196963061 X:121025038-121025060 ACATGTGGCCTGTACCTGGACGG - Intergenic
1199813873 X:151379292-151379314 ACCTGAGGCCCTCACCTCACTGG + Intergenic
1201180188 Y:11335329-11335351 AACTGAGGCCCGCAGCGGGCTGG - Intergenic
1201627078 Y:16026381-16026403 GATTGTGTCCCGCACCTGGCTGG + Intergenic