ID: 1002182475

View in Genome Browser
Species Human (GRCh38)
Location 5:177437957-177437979
Sequence CAGTGGGCCTCATTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002182475_1002182480 6 Left 1002182475 5:177437957-177437979 CCTGGAGATAATGAGGCCCACTG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1002182480 5:177437986-177438008 GTCCTGCCCTTACATTCTAGTGG 0: 1
1: 1
2: 2
3: 15
4: 115
1002182475_1002182481 7 Left 1002182475 5:177437957-177437979 CCTGGAGATAATGAGGCCCACTG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1002182481 5:177437987-177438009 TCCTGCCCTTACATTCTAGTGGG 0: 1
1: 1
2: 2
3: 30
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002182475 Original CRISPR CAGTGGGCCTCATTATCTCC AGG (reversed) Intronic
900343025 1:2197558-2197580 CAGTGGGCCTCATTTACCCTTGG + Intronic
900906799 1:5565017-5565039 CTGTGGGCCTCAGTCTCACCGGG - Intergenic
901748886 1:11393759-11393781 CAGTGCCCCTCCTTCTCTCCAGG + Intergenic
904212768 1:28896925-28896947 CAGTGGGCCCCATTGGCCCCAGG - Intronic
905897886 1:41560604-41560626 CAGAGGACCTCATTGCCTCCCGG + Intronic
906068028 1:42996256-42996278 CAGTGGGCATCAAAATGTCCTGG - Intergenic
907450960 1:54545615-54545637 CTCTGGGCCTCATTGTCCCCGGG + Intronic
908167910 1:61476501-61476523 AATTGAGCCTCATCATCTCCTGG + Intergenic
912584608 1:110750958-110750980 CAGAGGCCCTCAGTGTCTCCTGG + Intergenic
913181634 1:116328154-116328176 CAGTGTGCCTCAGAATCACCTGG + Intergenic
918526722 1:185472940-185472962 TAGTGGGCTTCATTATCACTGGG - Intergenic
922766802 1:228160267-228160289 CAGGGGGGCTCATTAGCCCCTGG + Intergenic
1069349979 10:67513624-67513646 AAGTGAGCCCCATTCTCTCCAGG - Intronic
1070401064 10:76053979-76054001 CAGTGGGCATCAGTATTTCCTGG - Intronic
1072158706 10:92746889-92746911 CAGTGAGCCTCTTGCTCTCCTGG + Intergenic
1073398941 10:103241240-103241262 CAGTGACCCTCTTTTTCTCCAGG - Intergenic
1074061228 10:109967665-109967687 CCGAGGGCCTCTTTTTCTCCAGG + Intergenic
1075435051 10:122432710-122432732 CAGAGGGCATCTTAATCTCCGGG + Exonic
1075677069 10:124303250-124303272 CAATGGGCTTGATCATCTCCCGG - Intergenic
1076259225 10:129052462-129052484 GAGTGGGTCTCATGATCTCATGG - Intergenic
1077501604 11:2912041-2912063 GAGGGAGCCTCATCATCTCCTGG - Intronic
1081714545 11:45239529-45239551 CAGTGGTACTCATGAACTCCTGG - Intergenic
1087043869 11:93828302-93828324 CAGAGGGTCTCACCATCTCCAGG - Intronic
1087059628 11:93964878-93964900 CAGTGGGTCTAATTATCTGCTGG - Intergenic
1088082649 11:105937834-105937856 AACTGGGCCTCATTTTTTCCAGG - Intronic
1090436252 11:126689123-126689145 CAGTGGGCCAGTTTATCACCTGG - Intronic
1094267887 12:28579766-28579788 GAATAGGCCTCATTATCTTCTGG + Intronic
1101312908 12:103599862-103599884 CAGTGGGCCTCTTTATTTCAGGG + Intronic
1105445100 13:20447106-20447128 CAGTGAGCCTCATCATCTACTGG - Intronic
1105795477 13:23848205-23848227 CAGTGTGCCTGCTTTTCTCCAGG - Intronic
1116848235 14:49884199-49884221 AGGTGGGGCTCATTATCACCTGG + Intergenic
1120428020 14:84375507-84375529 CAATGGGCCTAACTTTCTCCAGG + Intergenic
1121440377 14:93945093-93945115 CAGTGGGGCTCCTTCTCTCCTGG + Intronic
1121699825 14:95944206-95944228 CTCTGGGCCTCAGTTTCTCCAGG - Intergenic
1121834423 14:97079165-97079187 CTGGGGGCCTCAGTTTCTCCAGG - Intergenic
1125279033 15:38025067-38025089 CAGGGTGCCTCATTATAACCTGG + Intergenic
1125741822 15:41970627-41970649 GAGAGGGCTGCATTATCTCCAGG + Intronic
1127047108 15:55037604-55037626 CAGTGGGCATCAGCATCACCAGG + Intergenic
1133775800 16:8894247-8894269 GTGTGGGCCTCCTTAGCTCCAGG - Intronic
1137451804 16:48582771-48582793 CAGTGGTCCCCCTTATCTGCTGG - Intronic
1138845819 16:60564477-60564499 CACTGGGCCACATTGTCTCTGGG + Intergenic
1141164703 16:81652653-81652675 CAGTGGCCCACATGAGCTCCAGG + Intronic
1141793902 16:86256583-86256605 CATTGGGCCTCATTGTCAGCAGG + Intergenic
1142333686 16:89472883-89472905 CAGTGAGCCTCTTGATCTCATGG - Intronic
1143251407 17:5525823-5525845 AAGTGGTCCTTATTATCCCCAGG - Intronic
1143733399 17:8894099-8894121 CCCTGGGCCTCAGTTTCTCCTGG + Intronic
1143771030 17:9168939-9168961 GAGTGGGCTTCATTATGGCCAGG + Intronic
1144202196 17:12951777-12951799 CTGTGTGCATCATTATGTCCTGG + Intronic
1145097380 17:20042371-20042393 AAGGTGGCCTCATTATCTCTGGG + Intronic
1146515447 17:33485684-33485706 CAGAGGGCCTCATCATTTCAAGG + Intronic
1148870645 17:50657098-50657120 CGGGGGTCCTCATTATCTTCTGG + Exonic
1150991751 17:70267784-70267806 CAGTGGGCCTCAGTTTTTGCAGG - Intergenic
1153201578 18:2653263-2653285 CAGTGGCCCTCAGTATCCTCGGG + Intergenic
1155135854 18:22991778-22991800 CAGTGGCCCTCCTTATCTGTGGG - Intronic
1156985137 18:43341943-43341965 CAGGGGACCTCATTATTTCCTGG + Intergenic
1158112808 18:53960443-53960465 TCATGGGCCTCATTATCTCGTGG + Intergenic
1158544248 18:58382224-58382246 CAGAGGGGCTCAGGATCTCCTGG + Intronic
1161738101 19:6004124-6004146 CAGTGGTCCTCATGCTGTCCTGG + Intronic
1163644327 19:18479856-18479878 CCTTGGGCCTCATTGTCCCCAGG - Intronic
1165889212 19:39100614-39100636 CACAGGCCCTCATTATCCCCCGG - Exonic
1166462695 19:43003258-43003280 CCGTGGCAATCATTATCTCCTGG + Intronic
1166468831 19:43059715-43059737 CCGTGGCAATCATTATCTCCTGG + Intronic
1166479977 19:43163236-43163258 CCGTGGCAATCATTATCTCCTGG + Intronic
1166757631 19:45203163-45203185 CAGTGGGCCTCATGCCCTCCAGG + Intronic
925953282 2:8936312-8936334 TTGTGGGCCTCAGTATTTCCAGG - Intronic
927832613 2:26365726-26365748 CAGTGGTACTCAGTTTCTCCAGG - Intronic
929172130 2:38942873-38942895 CAGTGGGCTTCATTATAGACAGG + Intronic
930713475 2:54571307-54571329 CACTGAGCCTCATTTTCTTCAGG + Intronic
932838040 2:75055760-75055782 GAGTGGGCTTCAGTATCACCTGG + Intronic
935122290 2:100193499-100193521 CCGTGGGCCTCATTTCCTCCAGG + Intergenic
938227265 2:129626760-129626782 CAGTGGGCCTCTTCTTCTCCAGG - Intergenic
942011230 2:171764307-171764329 CAGTAGTCCTCCTTATCTGCAGG - Intergenic
945321523 2:208429460-208429482 CAGTAGCCCTCTTTATCTCTAGG + Intronic
946344299 2:219095772-219095794 CAGTCCTCCTCATTACCTCCTGG - Intronic
1170656696 20:18293385-18293407 CAGCAGGCCTCACTCTCTCCAGG + Intronic
1171167568 20:22985404-22985426 CAGTGGGCCTCACCTTTTCCTGG - Intergenic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1174447773 20:50602137-50602159 CCGTGGGCCTCAGCAACTCCAGG + Exonic
1175415180 20:58796300-58796322 TTGTGGGCCTCATCATCTCCAGG - Intergenic
1176219861 20:63964756-63964778 CTGTGGGCCCCATTACCCCCAGG + Intronic
1177853662 21:26377765-26377787 CAGTGGTTCTCTTTTTCTCCAGG + Intergenic
1179347114 21:40568927-40568949 CCATGGGCCTCAGCATCTCCAGG + Intronic
1181587471 22:23861449-23861471 AAGTAGGCTTCATTATCTGCAGG + Intronic
1182024596 22:27108142-27108164 CTCTGGGCCTCAGCATCTCCAGG + Intergenic
1182406159 22:30133406-30133428 CAATTGGCCTCATTTTCTTCTGG + Intronic
1182406270 22:30134503-30134525 CAATTGGCCTCATTTTCTCCTGG - Intronic
1182725011 22:32438096-32438118 CAGTGGTCCCCCTTATCTGCAGG + Intronic
1184505115 22:44895873-44895895 CAGTGGGTCTCAGGATGTCCCGG - Intronic
1184554877 22:45227715-45227737 CAGTGGGGCCCGTTCTCTCCCGG - Intronic
1184779602 22:46640477-46640499 CAGGTGGCCTCATTTCCTCCGGG - Intronic
949575950 3:5339393-5339415 TGGTGGGCCTCAGAATCTCCTGG + Intergenic
949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG + Intergenic
951780016 3:26352248-26352270 AAGGGGGCCTCAATATCTGCTGG + Intergenic
954083329 3:48225075-48225097 CAGAGCCCCTCACTATCTCCGGG + Intronic
961816007 3:129550741-129550763 CTGTAGGCCTCAGCATCTCCTGG - Exonic
961959868 3:130843636-130843658 AAGTTGGCCTCATTCTCTCTGGG - Intergenic
962859434 3:139385818-139385840 CAGTGGGCTTAATTCTCTCTAGG + Intronic
963854178 3:150237326-150237348 CAGTAGCCCCCATTATCTGCAGG - Intergenic
966060291 3:175746507-175746529 CAGTGTACTTCATTATCTACTGG - Intronic
966936983 3:184717150-184717172 CACTGGGCCTCATTGTGTCCAGG - Intergenic
967086736 3:186101885-186101907 CAGTGGACCTCATTGTCCCTTGG - Intronic
970484479 4:16510443-16510465 GAGTGGGCCTGAGTATCTGCTGG - Intronic
971049001 4:22839479-22839501 CAGTGGGCATCAGTGTCACCTGG + Intergenic
971866480 4:32178428-32178450 CAGGTGGCCTCATTCTTTCCAGG + Intergenic
973171236 4:47146651-47146673 CAGTGTGCATAATTATCACCAGG - Intronic
975278498 4:72532274-72532296 TAGTGGGCATCAGGATCTCCTGG - Intronic
975366759 4:73538649-73538671 CAGGGGGCCTCAAAATTTCCTGG + Intergenic
975464387 4:74693037-74693059 CAGTGGGCCTCACTGTTGCCAGG - Intergenic
978057162 4:104284594-104284616 CAGTGGGCCTCATGTTTTCAAGG + Intergenic
978605736 4:110476846-110476868 CAGAGGGCCTCTTCAGCTCCGGG - Exonic
982567957 4:157010071-157010093 CAGCTGGCCTCATAAACTCCTGG + Intergenic
984458141 4:179997055-179997077 TAGTGGGCATCAGAATCTCCTGG - Intergenic
985873251 5:2575598-2575620 CAGTGAGTCTCATTTTCTCTTGG - Intergenic
986243133 5:5979494-5979516 CAGAGGGCAGCAGTATCTCCTGG + Intergenic
988720990 5:33878916-33878938 CAGCGGGCATCAGAATCTCCTGG + Intronic
989346043 5:40430574-40430596 CAGTGTTCCTACTTATCTCCAGG - Intergenic
995787047 5:115841598-115841620 CAGTGGGCGTGCTTTTCTCCAGG + Exonic
998788388 5:145737856-145737878 CAGTGGGGCTCATTACCTGCTGG - Intronic
999526981 5:152417445-152417467 CAGTTGTCCTCGTTATCTGCAGG + Intronic
1002182475 5:177437957-177437979 CAGTGGGCCTCATTATCTCCAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003105195 6:3210184-3210206 CAGTGGGCCACATCAGCTCCTGG - Intergenic
1005209900 6:23448493-23448515 CAGAGGGCCGCATGTTCTCCAGG - Intergenic
1006137472 6:31904057-31904079 CAGTGGGCCTCATTTGGTACAGG - Intronic
1006517123 6:34551287-34551309 CGGTGGGCCTCTGTACCTCCAGG - Intronic
1014304001 6:119717317-119717339 CTGTGGGCCTCATGGTCCCCAGG + Intergenic
1015120261 6:129693228-129693250 CTGTGAGTCTCCTTATCTCCAGG - Intronic
1015135651 6:129866865-129866887 CAGTGGGCATCAGAATCACCTGG + Intergenic
1016024869 6:139276676-139276698 CTGTGGGTCTCATAATCTGCAGG + Intronic
1016515988 6:144893483-144893505 CAGTGGGCCCTGTTTTCTCCAGG - Intergenic
1017065561 6:150526009-150526031 AAGTTGTACTCATTATCTCCGGG - Intergenic
1018217834 6:161547901-161547923 CAGTGGGGCTCATAAAATCCTGG - Intronic
1018940743 6:168307828-168307850 CAGTGGGCCACCTGCTCTCCTGG + Exonic
1022626883 7:32045728-32045750 CAATGGGCCTTAATATATCCTGG + Intronic
1024452487 7:49563752-49563774 AAGTTGGCCTCATTTTTTCCTGG - Intergenic
1030991220 7:116302827-116302849 CAGTGGACCTGATTTTCTCCAGG + Intronic
1031151865 7:118063095-118063117 CAGTGGGCCTCAGGGTCTCAGGG - Intergenic
1031942032 7:127799142-127799164 CAGTGTGCCTAAGAATCTCCTGG - Intronic
1033256573 7:139806706-139806728 CATTCTGCTTCATTATCTCCAGG + Intronic
1038771706 8:30488898-30488920 CAGCGGACCTGATTATATCCAGG + Intronic
1039153589 8:34530511-34530533 CATTGGGACTCATTATCTAGTGG - Intergenic
1039805249 8:40992220-40992242 CAATGGACCTCACCATCTCCAGG - Intergenic
1041195748 8:55399929-55399951 CAGGGAGCTTCAGTATCTCCAGG + Intronic
1041713769 8:60915207-60915229 CCTTGGGCCTCCTTCTCTCCTGG + Intergenic
1042733062 8:71958150-71958172 CAGTGGGCCTCTGGAACTCCAGG - Intronic
1046155314 8:110281626-110281648 CAGTGTTACTCATTATTTCCAGG - Intergenic
1046177867 8:110602746-110602768 TATTGGGACTCATTATTTCCAGG + Intergenic
1049923722 9:389174-389196 CAGTGTGCCTGATAATGTCCTGG - Intronic
1051118949 9:13730637-13730659 AGTTGGGCCTCACTATCTCCTGG - Intergenic
1055251222 9:74308498-74308520 AAGTGGACCTCATTCTTTCCGGG - Intergenic
1057089625 9:92245588-92245610 CAGTGGGCCTCCCTATCAGCGGG - Intronic
1057555127 9:96082110-96082132 CAGTCGGCCTCTGTATCTGCAGG - Intergenic
1059535983 9:115081276-115081298 CAATGGGCTTAATTATCTTCAGG + Intronic
1061393575 9:130331292-130331314 CAATGTTCCTCTTTATCTCCTGG + Intronic
1062743734 9:138197207-138197229 CAGGGGGCCTCCTGATCTGCAGG + Intergenic
1185496935 X:561680-561702 CAGTGAGCCCTATGATCTCCCGG - Intergenic
1191976904 X:66882594-66882616 CTGTGGGCATCATTATCACTTGG + Intergenic
1195385018 X:104305867-104305889 GAGTGGGCCTCAGCATCCCCTGG - Intergenic
1195607406 X:106823223-106823245 CAGTAAAACTCATTATCTCCTGG + Exonic
1195638966 X:107153197-107153219 GAGTGGACTTCATTATCTGCAGG - Exonic
1195869431 X:109470768-109470790 CAGTGGGCATCAGAATCCCCTGG - Intronic
1197167488 X:123393929-123393951 CATTGGGCATTATTATCTTCTGG - Intronic
1197568789 X:128122645-128122667 CTGTGGCCCTAACTATCTCCAGG - Intergenic
1197592333 X:128423664-128423686 CAGTGAGCATCAGGATCTCCTGG + Intergenic
1198528003 X:137521595-137521617 CCGTGGACACCATTATCTCCTGG + Intergenic
1199099435 X:143781546-143781568 AAGTAGGCCTCATTTTCTTCTGG + Intergenic
1199428798 X:147735212-147735234 CAGTGGGCCACATGTGCTCCAGG + Intergenic