ID: 1002183432

View in Genome Browser
Species Human (GRCh38)
Location 5:177442982-177443004
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 2, 1: 0, 2: 12, 3: 91, 4: 695}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002183412_1002183432 27 Left 1002183412 5:177442932-177442954 CCAGGGGTCTTCCTGCTCCCCTG No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183424_1002183432 2 Left 1002183424 5:177442957-177442979 CCAGCTGGAAGCGGGAAGGGATT No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183417_1002183432 10 Left 1002183417 5:177442949-177442971 CCCCTGGCCCAGCTGGAAGCGGG No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183423_1002183432 3 Left 1002183423 5:177442956-177442978 CCCAGCTGGAAGCGGGAAGGGAT No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183420_1002183432 8 Left 1002183420 5:177442951-177442973 CCTGGCCCAGCTGGAAGCGGGAA No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183415_1002183432 16 Left 1002183415 5:177442943-177442965 CCTGCTCCCCTGGCCCAGCTGGA No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695
1002183419_1002183432 9 Left 1002183419 5:177442950-177442972 CCCTGGCCCAGCTGGAAGCGGGA No data
Right 1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG 0: 2
1: 0
2: 12
3: 91
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002183432 Original CRISPR AGGTGGGCCTGGAGGGAAGC AGG Intergenic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900207609 1:1438293-1438315 AGCTGCGCCTGGAGGGGACCAGG + Intronic
900291996 1:1927560-1927582 AGAGGGGCCTGGAGGGAAGCAGG + Intronic
900392054 1:2437997-2438019 AGGCGGGCCTGGAGGGACCTTGG - Intronic
900421130 1:2556407-2556429 AGGTGGGCCCTGCGGGAGGCAGG - Exonic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900561563 1:3309679-3309701 AGCTGGTCCTGCAGGGATGCGGG - Intronic
900569051 1:3349421-3349443 AAGTGGCCATGGCGGGAAGCAGG + Intronic
900604721 1:3518860-3518882 AGGCCCGCCTGGAGGGGAGCTGG - Intronic
901002173 1:6154349-6154371 ACGTGGGCCTGGAGGGAGGGCGG - Intronic
901006018 1:6171869-6171891 AGGTGGGCCAGGAGGGTGGTGGG - Intronic
901014814 1:6222632-6222654 TGGTGGGCCTGGTGTGAAGGTGG + Exonic
901194676 1:7433746-7433768 AGTTGGGCTGGGAGGGAAGTGGG + Intronic
901249096 1:7759422-7759444 AGGTAGGCCTGAAGGAAAGGGGG - Intronic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901456749 1:9367540-9367562 AGGTAGGCCTTGAGGGAAGCCGG - Exonic
901491110 1:9596825-9596847 AGGTGGGACTCGAGGCAGGCAGG - Intronic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901807133 1:11745629-11745651 AGGTGGCCCAGGAGTGAAGGAGG - Intronic
901828670 1:11879080-11879102 TGGTGGGCCTGGAGGATGGCTGG + Intergenic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
902183822 1:14710453-14710475 AGGTGAGGCTGGTGAGAAGCTGG - Intronic
902206490 1:14871904-14871926 GGGTGGGCCAGGAGGAAATCAGG + Intronic
902206762 1:14874008-14874030 GGGTGGGCCAGGAGGAAATCAGG + Intronic
902318933 1:15646052-15646074 AGGTGAGCATGGAGGGAGACAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902618875 1:17639051-17639073 AGGTGGTGCTGGGGGGAGGCTGG - Intronic
902649752 1:17829411-17829433 AGGAGGGCCTGGAGAGGAGATGG + Intergenic
903003023 1:20279822-20279844 ATGTGGGCCAGGAAGGAGGCTGG + Intergenic
903536636 1:24071303-24071325 AGGTGGGGCTGGAAGGGAGCGGG - Intronic
903859189 1:26354838-26354860 AGGGGTGCCTGGAGGGCAGGGGG - Intergenic
904258050 1:29269492-29269514 AGGCTGGCCAGGACGGAAGCTGG + Intronic
905865493 1:41374193-41374215 AGGAAGGCCAGGAGGGAAGGAGG + Intronic
906246172 1:44275832-44275854 AGGTGGGCTTCTGGGGAAGCAGG - Intronic
906531563 1:46526728-46526750 AGGTGAGCCTGGAGGCCAGTGGG + Intergenic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906947232 1:50305367-50305389 AGGTGGGCTAGGAGGAAAGGAGG + Intergenic
907290696 1:53410728-53410750 AGTTGCGGCTGGAAGGAAGCTGG - Intergenic
907337326 1:53708681-53708703 GGATGGGCCTGGAAGTAAGCTGG - Intronic
908534555 1:65066420-65066442 AGGTGAGCCCGGGGAGAAGCGGG + Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
912261948 1:108119623-108119645 AGCTGGGCTTGAAGGGAAGAAGG - Intergenic
912383610 1:109260606-109260628 AGATGGGCCTGCAGGACAGCGGG - Intronic
912466291 1:109877230-109877252 TGGTGGAGCTGGAAGGAAGCTGG - Intergenic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
912727142 1:112068415-112068437 AGGGAGGCCAGGAGTGAAGCTGG + Intergenic
912796512 1:112696652-112696674 AGGTGATCCAGGAGGGCAGCTGG + Exonic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
913528681 1:119716870-119716892 TGGTGAGCATGGAGGGAAACAGG - Intronic
914703029 1:150150633-150150655 CGCAGGGCCTGGAGGGAACCTGG + Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915268400 1:154734631-154734653 AGATGGGCCTGGAAGGAGACAGG + Intronic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915287022 1:154859565-154859587 AGGGGGCCCTGCAGGGAGGCAGG - Intronic
915313467 1:155015910-155015932 AGGTGGTCCTGGAGGGACTGGGG + Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
915368142 1:155326751-155326773 AGGTGGGCCTGGAGGGGCAGGGG - Exonic
915856197 1:159389003-159389025 AGGTGAGCTTGAAGGGAAGATGG + Intergenic
916099994 1:161386388-161386410 GGGTGGGCCTGTAGGTAAGGTGG + Intergenic
917512447 1:175679606-175679628 AGGAGGGATTGGAGGGAGGCTGG + Intronic
917590187 1:176468561-176468583 AGGTGGGCATGGAAAGAATCAGG + Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918139852 1:181711068-181711090 AGGTAGGCCTGGGGGGCTGCAGG + Exonic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919920021 1:202162008-202162030 AGGACAGACTGGAGGGAAGCAGG + Intergenic
920071975 1:203308520-203308542 AGGAGGGTCTGGAGGAAAACTGG + Exonic
920188512 1:204177528-204177550 AGCAGGGCCTGAAGGGAAGAGGG + Intergenic
920284410 1:204869132-204869154 ATGTGGGGCTGGAGGGAGCCAGG + Intronic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
921016532 1:211197319-211197341 AGGGGGGCCGGGAGGGAGGCCGG + Intergenic
922215375 1:223516035-223516057 AGGTGGCGGGGGAGGGAAGCTGG - Intergenic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922734295 1:227971208-227971230 AGTCGGGCCTGGAGAGCAGCCGG - Intergenic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
924777463 1:247119893-247119915 AGGTGGGCCTGGAGGGTGGTGGG + Intergenic
924803981 1:247348031-247348053 AGGTGGGCCTGGAGCCCGGCGGG + Intergenic
1063429590 10:5977331-5977353 ACGTGGAGCTGGAGGGAACCGGG - Intronic
1063452922 10:6163606-6163628 AGGTGCACCTGGGAGGAAGCAGG - Intronic
1064143283 10:12807793-12807815 AGGGGGGCCTGCAGTGGAGCTGG - Intronic
1065588154 10:27240528-27240550 AGGAGGCCCGGGAGCGAAGCGGG + Intronic
1066174733 10:32891673-32891695 AGCTGGGTCTGGAGGGTAACAGG + Intergenic
1066630037 10:37450262-37450284 AGGTGGGCCTTTTGGGAAGGTGG - Intergenic
1066975923 10:42367685-42367707 AGCTGGGCCAGGAGGGACTCGGG + Intergenic
1067015403 10:42754073-42754095 AACTGGGCCTGGAGGGGTGCTGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067060107 10:43073921-43073943 AGGTTTGCCTGGCGGGAGGCGGG - Intergenic
1067190557 10:44064484-44064506 AGGGGAGGCTGGAGGGAGGCTGG - Intergenic
1067288750 10:44926563-44926585 AGGTGAGCCAGCAGGGCAGCTGG + Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1068408407 10:56624077-56624099 AGGTGCTCCTGGATGGCAGCAGG + Intergenic
1069622770 10:69847986-69848008 AGGTGGGCCAGGGGGCAAGAAGG - Intronic
1069630286 10:69893472-69893494 AGGTGGCCCTGTTGGCAAGCGGG + Intronic
1069702801 10:70438986-70439008 AGGTGGGCCAGGAGGACATCAGG - Intronic
1070311410 10:75276311-75276333 AGGTGGGCCTGGGGGAAGGAAGG + Intergenic
1070550776 10:77488993-77489015 AGGTGGGCCTTGAGTGGAGCAGG - Intronic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1071508240 10:86245779-86245801 AGCTGTGGCTGGTGGGAAGCGGG - Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071967955 10:90872079-90872101 AGGTTGGCCAGGCGCGAAGCCGG - Intronic
1072634037 10:97165838-97165860 AGGTGGCCTTGGAAGGAAGGAGG - Intronic
1072695394 10:97599571-97599593 AGGTGGCCCTGTAGTGAAGCAGG + Intronic
1072811619 10:98466974-98466996 AGGTGGGGGTGGAAGGGAGCTGG - Intronic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1072900744 10:99404432-99404454 AGGTGGGACTGGGGGGAATCTGG + Intronic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1073472291 10:103730406-103730428 AGGTGGGGCTGGAAGGACACAGG - Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1074979735 10:118609919-118609941 AGGTGGGCCTGGGTGAGAGCAGG + Intergenic
1075074398 10:119341189-119341211 AGGTGCGCCTGGAGGGAGCAAGG - Intronic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075438439 10:122461560-122461582 AGGAGGGCCTCGGGGGCAGCGGG - Exonic
1075686318 10:124367568-124367590 AGGTGGGCATGGAGGCATGGAGG - Intergenic
1075955008 10:126516123-126516145 AGGTCGGCCTGGGGCCAAGCAGG - Intronic
1076239365 10:128892466-128892488 AGGTTAGCCTGGAGGGACTCTGG - Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076643783 10:131937344-131937366 AGCTGAGCCTGGAGGGCAGTGGG - Intronic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1077014100 11:392398-392420 AGGTGGGCCTGGGGTGGACCTGG + Intergenic
1077026396 11:441827-441849 AGGTGGGGCTGGCGGGGGGCTGG + Intronic
1077103592 11:832703-832725 AGGCGGGCCCGGAGGTAAGACGG - Intergenic
1077211013 11:1370974-1370996 ACCAGGGACTGGAGGGAAGCTGG + Intergenic
1077268969 11:1666244-1666266 AGGGGGTCCTGGAGGGCAGGGGG - Intergenic
1077271633 11:1684600-1684622 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271681 11:1684712-1684734 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271723 11:1684807-1684829 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077328305 11:1973113-1973135 AGGCGGGCCAGGTGGGGAGCAGG - Intronic
1077452298 11:2655689-2655711 AGGAGAGCATGGAGGGGAGCTGG - Intronic
1077652487 11:3985769-3985791 AGTTAGGTCTGAAGGGAAGCAGG - Intronic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1080002871 11:27370644-27370666 AGATTGGCCAGGAGGAAAGCTGG - Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083463901 11:62832790-62832812 AGCCGGGCCTGGAGGCAGGCAGG - Intronic
1083540841 11:63510667-63510689 AGCTGGGCCTGGAGAGGGGCTGG - Intronic
1083893771 11:65610179-65610201 AGGTGGTCATGGAGGGCACCTGG - Intronic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084337730 11:68470665-68470687 AGCTGGGACTGAAGGGGAGCAGG + Intronic
1084447574 11:69212688-69212710 AGGTGGGCCTGGTGGCAAGGTGG - Intergenic
1084587083 11:70068589-70068611 ACGTGAGCCAGGAGGGAAGGAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085028466 11:73254780-73254802 AGCTGGTCCTGGATGGAATCTGG - Intergenic
1085258376 11:75190256-75190278 ACATGAGCCTGGAGGGAATCAGG + Intronic
1085347112 11:75775337-75775359 AGGTGTGCCAGGTGGGAAGTGGG - Intronic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1087635209 11:100694552-100694574 AGGTGGAGCTGCAGGGAGGCTGG - Intronic
1087983703 11:104650638-104650660 AGCTGGGGTTTGAGGGAAGCTGG - Intergenic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089012070 11:115139623-115139645 AGGGGGGCCAGCTGGGAAGCAGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089385142 11:118062430-118062452 AGCAGGGCCTGGAGAGGAGCTGG - Intergenic
1089541149 11:119189633-119189655 AGGTGGGCCTGCAGGAAGGGAGG - Exonic
1089874162 11:121703992-121704014 AGGAGGCCCACGAGGGAAGCAGG + Intergenic
1090374603 11:126279994-126280016 AGGGGGCCAAGGAGGGAAGCTGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091192862 11:133708793-133708815 AGGTGGGCCTGGGGCCAAGGTGG - Intergenic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1202811283 11_KI270721v1_random:28292-28314 AGGCGGGCCAGGTGGGGAGCAGG - Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091936720 12:4440751-4440773 AGATGGGGCTGGAGAGCAGCGGG - Intronic
1092594442 12:9986019-9986041 AGCTGGGCCTAGAGGGAAGGGGG + Intronic
1094424301 12:30302647-30302669 AGGTGTCCCTGGGGGGAATCTGG + Intergenic
1095752629 12:45729072-45729094 AGGCTGGCGGGGAGGGAAGCAGG + Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096095489 12:48932772-48932794 AGGTGGAAGTGGGGGGAAGCAGG + Intronic
1096323970 12:50641660-50641682 AGGTGTGCCTGCATGGCAGCGGG + Intronic
1096530492 12:52239619-52239641 GGGTGGGACTGGAAGGAACCAGG + Intronic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1096996624 12:55842268-55842290 AGGTGGGCCTGGGGAGAGGAAGG + Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097182980 12:57181343-57181365 AGGTGGGGCTGTAGGGTAGGAGG - Intronic
1100391338 12:94148482-94148504 AGATGGGCGTGGAGGGAGGGCGG + Intergenic
1101727092 12:107396800-107396822 AGGGCTGCCTGGAGGGAAGGAGG - Intronic
1101745521 12:107538597-107538619 ACGGAGGCCTGGAAGGAAGCTGG - Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1101850335 12:108396877-108396899 AGGGGGCCCTGAAGGGAAGGAGG + Intergenic
1102164356 12:110794824-110794846 AGGTGGGCTGGGTGGGAGGCAGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1103930734 12:124449534-124449556 AGGTGGGTCTGGAGAGACGGAGG - Intronic
1104355006 12:128077539-128077561 AGGAGTGCCTGGAAGGAAACTGG - Intergenic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1104843216 12:131834428-131834450 GGGTGGGCGTGGAGGGGGGCAGG + Intronic
1106224457 13:27774579-27774601 AGGTGGGGCTGGAGGGACCGTGG - Intergenic
1106434093 13:29708517-29708539 AGGTAGGCGTGGGGGGGAGCAGG - Intergenic
1106477218 13:30109020-30109042 AGGGGAGCCTGGAGGGAGGTGGG - Intergenic
1107299066 13:38946639-38946661 GGAAGGGACTGGAGGGAAGCAGG - Intergenic
1107839071 13:44436972-44436994 AGGTGGGGGTGGGGGGAGGCGGG - Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1112214081 13:97412068-97412090 AGGTGAGACTGAAGGGAAGTTGG - Intergenic
1112509693 13:99998058-99998080 AGGTGGGCCCGGAGGGCGACGGG - Intergenic
1113113147 13:106846169-106846191 AGCTGGGCCTGAAGGGGTGCTGG - Intergenic
1113545470 13:111145696-111145718 AGGAGGCCCTGGCAGGAAGCAGG - Intronic
1113896184 13:113765981-113766003 AGGTGGGCCTGGAGGCAGGCGGG + Intronic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1114715427 14:24819016-24819038 AGGTGGGCCAAGAGAGGAGCAGG - Exonic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1119087615 14:71752175-71752197 AGCGGGGCCAGGAGGGAACCTGG - Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1119399005 14:74349273-74349295 CGGTGGCCCTGGAGGCCAGCTGG - Intronic
1119428879 14:74552839-74552861 AGCTGGCCCTGGAGGGTAGATGG - Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1121432150 14:93895176-93895198 AGGTGGGCCTGGGTGGCAGCAGG - Intergenic
1121843247 14:97151902-97151924 AGGCGGGCGTGCAGGGAAGAAGG - Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122214556 14:100194218-100194240 AGGTGGGGCTGGATGGACCCTGG - Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122650342 14:103222548-103222570 AGGTGGGGCAGGAGGGATGTGGG + Intergenic
1122736919 14:103848277-103848299 AGCTGGACCTCGAGGGATGCTGG - Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1123091881 14:105745575-105745597 AGCAGGGGCTGGTGGGAAGCAGG - Intergenic
1123105614 14:105839814-105839836 GGGTGGGCCTGGCAGGAGGCTGG + Intergenic
1123434716 15:20246782-20246804 AGGTGTGCCTGGAGGCAGGGAGG + Intergenic
1123967302 15:25471920-25471942 TGGCCGGCCTGGAGAGAAGCAGG + Intergenic
1124008142 15:25810980-25811002 AGCTGGGGCTGGAAGGAGGCGGG + Intronic
1124336052 15:28857925-28857947 AGGTGGGCCTGGGGGCTGGCCGG + Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124957052 15:34366732-34366754 AGGTGGGGATGGAGGGCTGCAGG - Intronic
1125389191 15:39173151-39173173 ATGTGTGCCTGCAGGGAAGGAGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1125760837 15:42094470-42094492 GGCTGGGCCTGGAGTGAAGCTGG - Exonic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128303251 15:66580717-66580739 AGAGGGGCCTGGAGAGAGGCAGG - Intergenic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128784806 15:70386958-70386980 AGGGGGGCGTGGAAGGAAGAAGG + Intergenic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129330725 15:74825995-74826017 AGCTGGGCCAGGAGGGACACTGG - Intergenic
1129882530 15:79016746-79016768 AGGTGGGCCAGAAGGAAGGCTGG + Intronic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130100035 15:80886303-80886325 AGGTGAGGCTGGAGGGGGGCGGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131955603 15:97732055-97732077 ATGTGGGCCTGGGAGGCAGCAGG + Intergenic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132558912 16:584663-584685 TGGTGGGCCAGGTGGGCAGCTGG - Intergenic
1132731142 16:1362560-1362582 TGGTGGGCCTGGCTGGGAGCTGG + Intronic
1132746401 16:1438146-1438168 AGGGGCGCTTGGAGGAAAGCCGG - Exonic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1132982420 16:2745294-2745316 ACACTGGCCTGGAGGGAAGCTGG + Intergenic
1133148228 16:3806755-3806777 AGGGGGCCTTGGAGGGAAGATGG - Intronic
1133206599 16:4237789-4237811 AGCTGGGCCTTGAAGAAAGCAGG - Intronic
1133326627 16:4945925-4945947 AGGTGGGGCAGGGAGGAAGCAGG - Intronic
1134012987 16:10868920-10868942 TGGCAGCCCTGGAGGGAAGCTGG - Intergenic
1134070165 16:11255777-11255799 AGGGGGGCGTGGAGAGCAGCCGG + Intronic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135534625 16:23283803-23283825 AGGTAGGGCTGGAGGGACACAGG + Intronic
1135757456 16:25109739-25109761 AGCTGGCCCTGGAGGTCAGCTGG + Intergenic
1137496086 16:48970420-48970442 AGGTGGGTCTGAAGGCGAGCGGG + Intergenic
1137599036 16:49743751-49743773 AGGTGGGCCTGGAGGGCCAGGGG + Intronic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137694163 16:50450018-50450040 AGCTGGGCCTGGAAGGCAGGTGG + Intergenic
1137791245 16:51176465-51176487 ATGTGGGCCTGGAGAGATCCTGG + Intergenic
1138481101 16:57303944-57303966 AGGCCGGCCAGGAGGGCAGCAGG - Intergenic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1140474107 16:75230022-75230044 AGCTGGGGCAGGAGGGAAGCAGG + Exonic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1140878234 16:79173215-79173237 AGGAGGCCCAGGAGGGGAGCAGG - Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1142032044 16:87843478-87843500 AGGGTGGCCTGGAGGGCTGCAGG + Intronic
1142105511 16:88300281-88300303 AGGTGGCCATGGATGGAGGCTGG + Intergenic
1142155162 16:88529668-88529690 AGGGGGTCCTGGAGGGCGGCAGG + Intronic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142213838 16:88821407-88821429 AGCTTGGCCTGAAGGGAAGTAGG - Intronic
1142244439 16:88963082-88963104 AGCTGGGCCTGGCAGGATGCTGG + Intronic
1142307575 16:89294118-89294140 GGGAGGGCCTGGTGGGGAGCGGG - Intronic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1142595698 17:1028878-1028900 AAGAGGGCCTGAAGGGAGGCCGG - Intronic
1142961105 17:3553099-3553121 GGGAGGGCCTGGAGGGATGGCGG - Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1142981947 17:3677467-3677489 AGGTGGCCATGGAGGCAACCAGG - Intronic
1143181830 17:4988179-4988201 AGCGGGGCCTGGAGGAAAACAGG + Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143453382 17:7050328-7050350 AGGTGGACAGGGAGGGAGGCGGG + Intergenic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143773917 17:9185603-9185625 GGGTAGGCCAGGAGGGAAACAGG + Intronic
1143784095 17:9244040-9244062 AGGTGGGCGTGTGGGGAGGCAGG + Intergenic
1145004594 17:19330174-19330196 AGGTGGGCCTGGAGGGGTGGAGG + Intronic
1145208378 17:20996403-20996425 AGGTGGGCCTGGTGGAAATGGGG + Intergenic
1145279285 17:21456199-21456221 GGGTGGGCCAGGAGCTAAGCAGG + Intergenic
1145763993 17:27445402-27445424 AGGTGGGACTGGAGTGATGTGGG - Intergenic
1146183142 17:30709704-30709726 AGCCGGGGCTGGGGGGAAGCTGG - Intergenic
1146640793 17:34539836-34539858 AGTTGGAGCTGGAGGGAAGGTGG - Intergenic
1146821114 17:35984271-35984293 AGGGCCTCCTGGAGGGAAGCAGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1148109657 17:45137324-45137346 AGGTGGGCCTGGGGAGAGGCTGG - Intronic
1148518128 17:48241364-48241386 GGGTGGTACTGAAGGGAAGCAGG + Intronic
1148606167 17:48930605-48930627 AGGTGTTCCTGGAGGGAAAAGGG + Exonic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148745711 17:49916853-49916875 ACGTGGGCCTGGTGGGGAGGAGG - Intergenic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1148998988 17:51737754-51737776 AAGGGGGGCTGTAGGGAAGCAGG - Intronic
1149448859 17:56733898-56733920 AGTTGGGGCTGGATGGAGGCAGG - Intergenic
1149510551 17:57237545-57237567 AGCTGGACCTTCAGGGAAGCAGG - Intergenic
1149602172 17:57900061-57900083 AGCTGGGCCTGCAGGGAACCAGG - Intronic
1149656417 17:58311715-58311737 AGGTGGGCCTGGGGGCAGGGGGG + Exonic
1149847053 17:60014344-60014366 AGATGGACCTGGACGTAAGCGGG - Intergenic
1150085412 17:62270961-62270983 AGATGGACCTGGACGTAAGCGGG - Intergenic
1150631233 17:66881822-66881844 AAATGGGCCTGGAGGAAAGTGGG + Intronic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151829115 17:76539118-76539140 TGGAGGGGCTGGAGGGGAGCGGG + Intronic
1151905098 17:77042671-77042693 AGGTGGGCCCAGAGAGCAGCTGG - Intergenic
1151954763 17:77374708-77374730 AGGTGGGCCGTGTGGGCAGCTGG - Intronic
1152039080 17:77891700-77891722 AATGGGGCCTGGAGGGAGGCTGG - Intergenic
1152182018 17:78828435-78828457 AGGTGGGCCTGAGGGAGAGCTGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152241251 17:79162414-79162436 TGGTGGGCCTGGCTGGAGGCAGG - Intronic
1152385939 17:79974795-79974817 AGGTGGGGCTGGTAGGAGGCTGG + Intronic
1152469571 17:80483189-80483211 GGGAGGGCCTGGAGGGAGGGAGG + Intergenic
1152720931 17:81923536-81923558 AGGCAGGCCTAGAAGGAAGCCGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152841699 17:82573287-82573309 AGGTGGGCCAGAGGGGAGGCTGG - Intronic
1153552440 18:6275553-6275575 AGGCAGGCCTGCAGGTAAGCAGG + Intronic
1153862245 18:9224577-9224599 TGGTGAGCTTGGAGTGAAGCTGG + Intronic
1154202372 18:12308348-12308370 AGGTGGGCCTGGCGCGGTGCAGG + Exonic
1154424360 18:14260729-14260751 AGCTGGGGCTGCAGGGATGCAGG - Intergenic
1154508694 18:15069859-15069881 AGGTGGGCTGGGAGGGAAAGGGG - Intergenic
1155071409 18:22320155-22320177 AGGTGAGCCTGTTGGGGAGCGGG + Intergenic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156861110 18:41837399-41837421 AGGCTGGCCTGGAGAGAAGACGG - Intergenic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158706356 18:59795842-59795864 CTGTGGGCCTGGAGGGTAACTGG + Intergenic
1159005201 18:63004787-63004809 AGGTGGGGCTGGGGCGATGCTGG + Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1160497305 18:79383111-79383133 GGGTGGGCCGGGAGAGAATCAGG + Intergenic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1161067959 19:2247813-2247835 AGGGGGGCCAGCAGGGAGGCTGG - Exonic
1161161818 19:2765836-2765858 AGGAGGGCGTGGGGGGAAGATGG + Intronic
1161620040 19:5292984-5293006 AGCTGGCCCTGGAGGGCGGCCGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1162353512 19:10166083-10166105 AGGAGGGCCTGCAGGCAACCTGG + Intronic
1162975653 19:14206070-14206092 AGCCGGGGCTGGGGGGAAGCGGG + Exonic
1162999329 19:14356227-14356249 GGGGTGGCCAGGAGGGAAGCTGG + Intergenic
1163064802 19:14785125-14785147 GGGGTGGCCAGGAGGGAAGCTGG - Intergenic
1163148755 19:15399144-15399166 AGCTGGGCCTGGCGGGAAGCAGG + Intronic
1163301475 19:16449995-16450017 AGATGGGCTGGGAGGGAAGTGGG + Intronic
1163451280 19:17378925-17378947 AGTTGGGCCTGGAGGGGATTTGG + Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163484189 19:17576672-17576694 AGGTGGGGCTGGGGGGGTGCAGG + Intronic
1164514313 19:28921314-28921336 AGGTGGGCCTGGAAGGATTTGGG + Intergenic
1164536188 19:29087949-29087971 TGGGGGGCCTGGAGGGAGGGAGG + Intergenic
1164835887 19:31354836-31354858 AGGTGTGCCTGGATGGGAGCTGG + Intergenic
1165028955 19:32983542-32983564 GGGTGGACCTGGAGGGGAACAGG - Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165532933 19:36418823-36418845 GGCAGGGCCTGGAGGGGAGCGGG + Intergenic
1165784143 19:38451296-38451318 AGGTCGGCTTGGGGTGAAGCTGG + Intronic
1165832695 19:38737117-38737139 AGCTGAGGCTGGAGGGAACCCGG - Intronic
1165858651 19:38895063-38895085 AGGAGGGCGAGGAGGGAGGCGGG - Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165931036 19:39358873-39358895 AGGTGGGCCTGGGGAGATGAGGG - Intronic
1166199002 19:41224196-41224218 AAGTGTGCCTGGAGGGTAGTGGG + Intronic
1166772280 19:45291002-45291024 AGGTGGCACAGGAGGGAGGCCGG + Intronic
1167146177 19:47681741-47681763 AGGTGGGGCAGGAGAGAGGCAGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167557878 19:50206732-50206754 AGGGGGGCCTCCAGGGCAGCTGG + Intronic
1167622976 19:50568964-50568986 AGAGGGGCCTGGAGGGCGGCGGG + Intergenic
1167689289 19:50975349-50975371 AGGAGGGGCTGGAGGGAGTCTGG + Intergenic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
1168467059 19:56611462-56611484 AGGGGGCACTGGAGGGAGGCTGG - Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926367903 2:12150424-12150446 AGGTGCGCATGGGGAGAAGCAGG - Intergenic
926875828 2:17477553-17477575 AGGTTGCCCTGCAGAGAAGCAGG + Intergenic
927484053 2:23476983-23477005 AGCTGGGCCTGGAATGAAGCAGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927714218 2:25341928-25341950 AGGCGGGCCGGGAGGGAGGGAGG - Intronic
927791743 2:26015604-26015626 AGGGGAGCCTGGAGGAAAGAAGG + Intergenic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
927870139 2:26618139-26618161 AGGTCGGGGTGGAGGGAGGCAGG - Intronic
927977275 2:27348289-27348311 AGCTGGGCATGGTGGGCAGCAGG + Intronic
928071610 2:28222908-28222930 GGGCGGGCCTGCGGGGAAGCAGG - Intronic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
929930551 2:46252408-46252430 ATTTGGGCCTGGGGGGAAGCAGG + Intergenic
930704912 2:54495184-54495206 AGGTTGGTCTGGAGGACAGCAGG + Intronic
931461871 2:62456959-62456981 TGGTTAGCCTGGAGGGGAGCTGG - Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931704899 2:64939162-64939184 AGGTTGGCTTGGAGGGAGGGAGG + Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932357362 2:71077635-71077657 AGGTGAGCCTGGGGGGAGGCTGG + Exonic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
932595793 2:73092830-73092852 AGGTGGGGCTGGAAGGGAGGTGG - Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933650581 2:84846996-84847018 AGGCTGCCCTGGAGGGAAGCTGG + Intronic
933940347 2:87239845-87239867 AGGAGGGCTTGCAGGGAGGCTGG - Intergenic
934141258 2:89050155-89050177 AGGAGGTCCTGGAGGAATGCCGG - Intergenic
934227982 2:90150389-90150411 AGGAGGTCCTGGAGGAATGCCGG + Intergenic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935069278 2:99679414-99679436 AGATGGGCCTGCAGAGAAGGTGG - Intronic
936327958 2:111521965-111521987 ACGAGACCCTGGAGGGAAGCTGG + Intergenic
936352791 2:111725931-111725953 AGGAGGGCTTGCAGGGAGGCTGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
937071615 2:119067829-119067851 AGATGGGCCTGGAGGGACTTGGG - Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937338384 2:121075881-121075903 AGGTGGGCAGGGAGGCGAGCTGG - Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
938094974 2:128455667-128455689 AGGTGGGTCTGCAGGGTAGATGG + Intergenic
938280130 2:130057890-130057912 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
938331087 2:130448605-130448627 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
938358861 2:130672898-130672920 AGCTGGGGCTGCAGGGATGCAGG - Intergenic
938435254 2:131279551-131279573 AGCTGGGGCTGCAGGGATGCAGG - Intronic
938928276 2:136064083-136064105 AGGTGGTCCTGAAGGGACGAGGG + Intergenic
939512421 2:143123493-143123515 ACGGGAGCCTGGAGGGAAGGAGG - Intronic
939994342 2:148906267-148906289 ATGAGTGCCTGGAGGGAACCAGG + Intronic
940801461 2:158137328-158137350 AGGTGAGCATGGAAGGAATCTGG - Intergenic
941096048 2:161239642-161239664 AGAAGGGCCTGGAAAGAAGCGGG + Intergenic
941619549 2:167760963-167760985 ATGTGAGCCTGGAGTGCAGCAGG + Intergenic
942247853 2:174023994-174024016 AGGGGGCCCTGGAGGCAAACTGG - Intergenic
942311185 2:174658439-174658461 AGGTGGGCCTGGAATTCAGCAGG + Intronic
942313994 2:174682243-174682265 GGGAGGGCCGGGAGGGAGGCGGG + Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945279618 2:208023802-208023824 ACCAGGGCCTGGAGGGAGGCAGG - Intronic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
945884013 2:215355504-215355526 AAGGTGGCCTGGAGAGAAGCAGG - Intergenic
946415652 2:219538527-219538549 AGCTGGGCCTGGAGAGGGGCAGG - Exonic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947582901 2:231332704-231332726 AGGGGGGCCTGGTGGGATGCTGG + Intronic
947669591 2:231927784-231927806 AGGGAGGCTTGGAGGGAACCTGG - Intergenic
947722426 2:232378191-232378213 AGGTGGGGCTGGCAGGAATCTGG - Intergenic
947999678 2:234557527-234557549 AGGTCAGCCTGCAGGGAAGTGGG + Intergenic
948053516 2:234995222-234995244 AAGGGGCCCTGGCGGGAAGCAGG + Intronic
948744327 2:240075348-240075370 AGCTGGGCCTGGCTGGCAGCCGG - Intergenic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168937239 20:1675966-1675988 AGGGAGGCAGGGAGGGAAGCAGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1170591112 20:17772704-17772726 AGGTCCGTCTTGAGGGAAGCAGG + Intergenic
1170669359 20:18416349-18416371 AGGTGGGACCGGAAGGAAGCTGG - Intronic
1170871762 20:20212656-20212678 AGGTGGGGGTGGAGGATAGCAGG - Intronic
1171406783 20:24917149-24917171 AGGTGGGCAGGGATGGAAGGTGG - Intergenic
1171439413 20:25148454-25148476 AGGTGGGCTTGGAGGGGCCCCGG - Intergenic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1172767037 20:37356452-37356474 AGATGGGCCTGGAGAGAAGCAGG + Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1172831329 20:37837712-37837734 AGGTGGGCATGGGGGCAAACAGG - Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173733248 20:45342653-45342675 AGGTGGGGGTTGGGGGAAGCAGG + Intronic
1174067375 20:47875193-47875215 AGGTGGGACTGGACGGGGGCAGG + Intergenic
1174156926 20:48521681-48521703 AGGTGGGACTGGACGGGGGCAGG - Intergenic
1174199861 20:48799703-48799725 AGGTTGTCCTGCAGGCAAGCGGG + Intronic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1175331561 20:58168240-58168262 GGGTGGGCCTGGAGGATGGCTGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1176135057 20:63518955-63518977 AGGCCAGCCTAGAGGGAAGCGGG + Intergenic
1176296226 21:5074965-5074987 AGGTGGGCCTGGCATGCAGCAGG + Intergenic
1176515546 21:7780813-7780835 AGGCAGGCATGCAGGGAAGCCGG - Intergenic
1176848187 21:13892516-13892538 AGCTGGGGCTGCAGGGATGCAGG + Intergenic
1177988540 21:28010053-28010075 AGGTGGGCTGGGAGGGAAAGGGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178649574 21:34410825-34410847 AGGCAGGCATGCAGGGAAGCCGG - Intergenic
1178723690 21:35032661-35032683 AGGTGTCCCTTGTGGGAAGCTGG - Intronic
1179156980 21:38859292-38859314 AGGTGGGGTTGCAGGGAAGGGGG + Intergenic
1179450689 21:41466553-41466575 AGGCAGGGCAGGAGGGAAGCTGG - Intronic
1179585182 21:42370152-42370174 AGGTGGCCCTGGAGGGAGGGAGG + Intergenic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179615908 21:42583464-42583486 AGCTGGGCCAGGTGAGAAGCAGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179860823 21:44187156-44187178 AGGTGGGCCTGGCATGCAGCAGG - Intergenic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1180091791 21:45537291-45537313 ATATGGTCCTGGAGGGAACCCGG - Intronic
1180160704 21:45997637-45997659 TGGTGACCTTGGAGGGAAGCAGG - Intronic
1180205127 21:46255148-46255170 AGGTGGGGCTGGAGCCAGGCAGG + Intronic
1180869841 22:19139900-19139922 AGGTGGCCAAGGAGAGAAGCCGG - Exonic
1180981304 22:19879400-19879422 GGGGTGGCCTGGAGGGATGCGGG - Intronic
1181099850 22:20531872-20531894 AGGGGTGCCTGGGTGGAAGCAGG + Intronic
1181107513 22:20583818-20583840 AGGTGGCGCTGGTGAGAAGCAGG + Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181162370 22:20966221-20966243 AGGTCAGCCAGGAAGGAAGCGGG + Intronic
1181853130 22:25764319-25764341 AGGTGGACCATGAGGGAGGCAGG + Intronic
1182293472 22:29299615-29299637 AGGTGGCCCTGGTGGCATGCGGG + Exonic
1183258340 22:36777583-36777605 AGGTTGGCCTGGAGGGGAGCCGG - Intergenic
1183266287 22:36827973-36827995 AGCGGGGGCTGGAGGGAAGGAGG + Intergenic
1183269744 22:36853674-36853696 AGGGGGCGCTGGAGGGAGGCCGG - Intergenic
1183379369 22:37483285-37483307 AGGAGGGCCTGCAGCAAAGCAGG - Intronic
1183467417 22:37986691-37986713 AGGTGGGCCTGCAGGGCGGGTGG + Intronic
1183469771 22:37999093-37999115 AGGTGGGCCTGCTGGGCAGCTGG + Intronic
1183658003 22:39201514-39201536 AGCTGGGCTTGGAGGGAAGTGGG + Intergenic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184100330 22:42338549-42338571 AGGAGGCCCGGGAGGGAGGCGGG + Intronic
1184254018 22:43276860-43276882 ATGCTGCCCTGGAGGGAAGCTGG - Intronic
1184405114 22:44296540-44296562 GGGTGGGCCTGGAAGGAGTCTGG - Intronic
1184881003 22:47304198-47304220 GCGTGGGCCTGCAGGGAGGCTGG - Intergenic
1184907333 22:47497756-47497778 AAGTAGGCCCTGAGGGAAGCCGG - Intergenic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1185369729 22:50455496-50455518 TGGTGGGCCTGGAGGATGGCTGG - Exonic
1185399348 22:50607913-50607935 GCCTGTGCCTGGAGGGAAGCTGG - Intronic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
949811139 3:8007445-8007467 AGGTGGGGGTGGTGGGAGGCGGG + Intergenic
950017709 3:9765931-9765953 AGGAGAGGCTGGAGGGAAGCTGG - Exonic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950222186 3:11204928-11204950 ACGTGGGGCTGGAGGGAGCCTGG - Intronic
950580728 3:13860316-13860338 TGGTGGGCCAGGAAGGGAGCTGG - Intronic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
951779648 3:26347770-26347792 AGGTGGGGCTGGAAGGACACAGG + Intergenic
951881513 3:27484589-27484611 AGATGGGGCGGGAGGGAGGCGGG + Intergenic
952211216 3:31231161-31231183 AGATGGGCCTGGAGGGCACCTGG + Intergenic
952980290 3:38728600-38728622 ATGTGGGCCTGCATGGAAGTTGG - Exonic
953026791 3:39149960-39149982 AGGTGGGCCTTGGGGTAATCAGG + Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
954134105 3:48574261-48574283 GGCTGGGCCTGAAGGGAAGCCGG - Exonic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954578441 3:51689889-51689911 AGCTGGACCTGGAGGGACCCTGG + Intronic
954840784 3:53509574-53509596 AGGTGAGGCTGGAGGGAATCAGG + Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955148884 3:56347389-56347411 AGGGGGCGCTGGAGGAAAGCTGG + Intronic
955952403 3:64255546-64255568 AGGAGAGCCTGGAGTTAAGCAGG + Intronic
956305631 3:67821331-67821353 AGGTGTGTCTGGATGCAAGCTGG - Intergenic
956384435 3:68701839-68701861 AGAGAGGCCTGGAAGGAAGCAGG - Intergenic
959833999 3:110896977-110896999 AAGTGGACCTGCAGGGGAGCCGG - Intergenic
961003492 3:123389577-123389599 ATGTGGGCCTGTATGGAACCAGG - Intronic
961457181 3:127030063-127030085 AGGTGGGCCTGGCTGGCAGATGG + Exonic
961479452 3:127170758-127170780 AGGTGGGCTTGGGGGGAGGTGGG + Intergenic
962368502 3:134801920-134801942 AGGGAGGCCTGGAGGGCAGTGGG + Intronic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
963042783 3:141081610-141081632 AGGAGGGCCTGGGGGACAGCAGG + Intronic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
964312330 3:155408106-155408128 AGCTGGGCCTGGAGGAAATATGG - Intronic
966883624 3:184362785-184362807 AGCAGGGCCTGGGGGGAAGAGGG + Intronic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
967824214 3:193865858-193865880 AGGAGGGGCTTGAGGGAAGAGGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968079995 3:195839450-195839472 AGCCGGCCCTGGAGGGAGGCAGG + Intergenic
968235967 3:197030089-197030111 AGTCGGGGCTGGAGGGCAGCTGG + Intergenic
968497591 4:927170-927192 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497602 4:927207-927229 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497637 4:927318-927340 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497659 4:927392-927414 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497681 4:927466-927488 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497701 4:927530-927552 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497712 4:927567-927589 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968497723 4:927604-927626 AGGTGAGCCGGGAGGGGTGCGGG - Intronic
968515192 4:1012696-1012718 AGGGGGCCCTGGAAGGAAGGGGG - Intronic
968581252 4:1396366-1396388 AGGTTGGCCCGGAGAGCAGCAGG + Intergenic
968591522 4:1462150-1462172 GGCTGGGACTGGAGGGAGGCGGG - Intergenic
968691316 4:1991868-1991890 AGGTGGCCCTGGGGTGAGGCGGG - Intronic
968768305 4:2486618-2486640 AGCTGGGCCTGCAGGGATGCAGG + Intronic
968878220 4:3285474-3285496 ACGGGGGCCTGGAAGGAAGGGGG + Intergenic
968914710 4:3492387-3492409 AGGTGGCCCTGGAAGGTAGTCGG + Intronic
968933985 4:3600371-3600393 AGGTGGGCCTGGAGCTAAGGGGG + Intergenic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969703320 4:8779491-8779513 AGGTGGGGCTGGACGTCAGCTGG - Intergenic
969895093 4:10296151-10296173 AGGTGTGCCTTAAAGGAAGCTGG - Intergenic
971254573 4:25002389-25002411 AGGTGGGCTGGCAGGGAAGTTGG + Exonic
971268406 4:25114663-25114685 AGGTGGGGGTGGTGGCAAGCAGG - Intergenic
972644415 4:40954132-40954154 AGGTGAGCCTAGGGGGAAGAGGG - Intronic
973161509 4:47023186-47023208 TGGGGGGCCTGAGGGGAAGCTGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975106858 4:70577340-70577362 AGGGGAGGCTGGGGGGAAGCCGG + Intergenic
976831652 4:89321700-89321722 AGGTAGGCATGGAGGGATACAGG + Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
982720130 4:158850626-158850648 AGTGGGGGCTGGAGGGAAGGAGG + Intronic
985494280 5:195932-195954 AGGTGGGCCTGCAGGGAACGCGG + Intergenic
985549368 5:525195-525217 GGGTGGGCTTGGAGGAAAACAGG - Intergenic
985666232 5:1182803-1182825 AGGTGGGCCTTGGGAGAGGCAGG - Intergenic
985913580 5:2901255-2901277 AGGAGGGCCTGAGGGGATGCTGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
986469844 5:8062772-8062794 AGACAGTCCTGGAGGGAAGCAGG + Intergenic
986514222 5:8543691-8543713 AGTTTGAACTGGAGGGAAGCTGG + Intergenic
986681005 5:10232755-10232777 AGGGGAGGCTGGAGGGGAGCAGG + Intronic
987317044 5:16733559-16733581 AGGAAGGCCTGGTGGGAAGAGGG + Intronic
988418357 5:30974773-30974795 AGGTGGGCATGGAGGGGGTCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
992249944 5:74866495-74866517 AGCCGGGGCTGGAGGGAGGCAGG - Intronic
992648937 5:78838386-78838408 AGGAGTGCCTGGAGTGAGGCTGG + Intronic
992773506 5:80070251-80070273 AGCTGAGCCTGGCAGGAAGCTGG - Intronic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
995127091 5:108589016-108589038 AGAGGGGCGTGGAGGGGAGCGGG + Intergenic
997610504 5:135212611-135212633 AGCTGGGCCTGATGGGAAGTGGG + Intronic
997626810 5:135336652-135336674 AGGTGGGCCAGGATGGAGGGCGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998140214 5:139695740-139695762 AGGTGGCCCTGGGTGGAGGCTGG + Intergenic
998352058 5:141508282-141508304 AGGTGGGCCTTGGGGGGAGTGGG + Intronic
998389572 5:141778820-141778842 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
998389808 5:141780224-141780246 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999047305 5:148483016-148483038 AGGTGGCGCTGGAGGGAGTCAGG - Exonic
999233795 5:150078526-150078548 TGGGGGGCTTGGAGGGAGGCAGG - Intronic
999441644 5:151605889-151605911 AGGTGACCCTGGAGGGGACCTGG + Intergenic
999697629 5:154200387-154200409 AGGGGCTCCTGGAGGGAAGGGGG + Intronic
1002063775 5:176642164-176642186 AGGTGGGGCAGGAGGTAAGGTGG + Exonic
1002105739 5:176878745-176878767 AGGTGGGCCTGGGGACAGGCGGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002491947 5:179584636-179584658 AGCTGGGCCTGGTGGCAAGGTGG + Intronic
1003249513 6:4413686-4413708 AGGTGGGCCTGGAGGAAGGTGGG - Intergenic
1003320006 6:5043049-5043071 AGGAGGTCCTGGTGGAAAGCTGG - Intergenic
1003554574 6:7128353-7128375 TGGGGGACCTGGAGGGGAGCTGG + Intronic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006050997 6:31344226-31344248 AGGTGGGCCTGGAGGGAGGGAGG + Intronic
1006100427 6:31683012-31683034 CCGTGGGCCTTGAGGGAACCGGG + Intronic
1006114965 6:31770642-31770664 AGGTGTCCCTGGTGGGAAGGTGG + Intronic
1006338325 6:33432287-33432309 AGTTGGGGCTGGAGGGGAGGGGG - Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1006920849 6:37626178-37626200 AGGAGGGCCTGCAGGGAGGAGGG - Intergenic
1007073756 6:39054041-39054063 AGGTGGGGCTGGGGTGAAGGGGG - Intronic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012410261 6:98948046-98948068 GGCGGGGCCTGGAGGGAGGCGGG + Intergenic
1012526036 6:100178793-100178815 TGCTGGGCCTGCAGGGAAGGAGG + Intergenic
1012895215 6:104940319-104940341 GGGTGCGACTGGAGGGAGGCGGG - Intergenic
1015201636 6:130588224-130588246 AGATGGGATTGGAGGGTAGCAGG + Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1017266794 6:152455456-152455478 AGGAGGGCCTGGAGGAAAAGGGG - Exonic
1017358784 6:153541994-153542016 AGGTGGGAATGGAGGTGAGCAGG - Intergenic
1017464887 6:154685588-154685610 AGCTGGGCATGGTGGGACGCTGG + Intergenic
1017526547 6:155246226-155246248 GCGTGGGCCTGGAGGGCATCTGG + Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017945224 6:159091092-159091114 AGGCGGGCCTGCAGGGATGGAGG - Intergenic
1017956222 6:159179917-159179939 AGTTAGGCTGGGAGGGAAGCAGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018616815 6:165694532-165694554 AGGTGGGGCAGGAGAGCAGCGGG + Intronic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019178794 6:170174904-170174926 AGGCGGGCCTAGAGGGATGGTGG - Intergenic
1019256549 7:56127-56149 AGGTGGTCCTGGGCTGAAGCAGG - Intergenic
1019280398 7:196937-196959 AGGGGGGCCTGGAGGGGGGCAGG - Intronic
1019319561 7:409460-409482 AGGTGGGCCGGGCGGGGAGCAGG - Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019879393 7:3845103-3845125 AGGTTGGCGGGGAGGGATGCTGG + Intronic
1020186089 7:5960642-5960664 AGGTGGGGCAGGAGTGAAGGGGG - Intronic
1020296826 7:6764128-6764150 AGGTGGGGCAGGAGTGAAGGGGG + Intronic
1021964728 7:25906170-25906192 ACGTGGGCCTGGAGGCTAGGAGG + Intergenic
1022207788 7:28180309-28180331 AGGTGGGGGTGGCGGGATGCGGG - Intronic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022530260 7:31062542-31062564 AGGTGGGCCTCCAGGCAGGCTGG + Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023845497 7:44117853-44117875 AGGTGGGGTTGTGGGGAAGCAGG - Intronic
1024095916 7:45982619-45982641 AGGTGATCCTGGTGAGAAGCCGG + Intergenic
1026111592 7:67462843-67462865 AGATGGGCCTCCAGGGCAGCAGG + Intergenic
1026493178 7:70880630-70880652 AGATGGGCCTGGCTGGATGCTGG + Intergenic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1027235043 7:76293134-76293156 AGGGGGGCCTGGAGGCCAGCAGG - Intergenic
1027673636 7:81132527-81132549 ATGTGGACCTCGAGGGATGCTGG + Intergenic
1028948122 7:96603734-96603756 AGGTGGGGTTGGAGGGAGGGAGG - Intronic
1028994564 7:97085892-97085914 AGGTGGGCTGGGTGGGAGGCGGG - Intergenic
1029422416 7:100478174-100478196 AGGAGGGCCTGGCGGGAACCGGG + Exonic
1029654608 7:101915960-101915982 AGGAGGGGCTGGAGGGTGGCGGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1032197616 7:129798605-129798627 AGGTGGGCCTGAAGGTGGGCTGG - Intergenic
1032488923 7:132309328-132309350 AGGTGGGGCTGGCAGGATGCTGG + Intronic
1032530862 7:132618543-132618565 AGGCAGAACTGGAGGGAAGCAGG - Intronic
1033773702 7:144582664-144582686 AGGTGCAGCTGGAGGGAAGCAGG - Intronic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034262694 7:149766530-149766552 ATGTGAACCTGGAGCGAAGCAGG - Intronic
1034277931 7:149831897-149831919 AGGTGGGCCTAGGGGCAGGCAGG - Intergenic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1037802627 8:22043756-22043778 AGGTGTGCATGGAGGGAGGTGGG - Intronic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038542478 8:28401821-28401843 AGGTGGGGCGGGAGGGAGGGAGG - Intronic
1039821410 8:41138534-41138556 AGAGGGGCCACGAGGGAAGCTGG + Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040568993 8:48591691-48591713 AGGTGGACCTGGGCGGGAGCCGG - Intergenic
1041238053 8:55824592-55824614 AGCTGGGCCTGGAGGGCAAGTGG + Exonic
1046221454 8:111221827-111221849 AGGTGGCACTTCAGGGAAGCAGG + Intergenic
1046349418 8:112987777-112987799 AGGAGGACCTGGAGGCAATCAGG - Intronic
1047524090 8:125617723-125617745 AGGTGAGTCTGGAAGGAGGCTGG + Intergenic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048083292 8:131151498-131151520 AGGTGGTCCATGAGGGAAGCTGG + Intergenic
1048268218 8:133005917-133005939 AGGTGAGCCGAGAGGAAAGCCGG - Intronic
1048310422 8:133318342-133318364 TGGTGGTCCTGGAGGGAGTCGGG - Intergenic
1048496176 8:134938001-134938023 AGGTGGTCTTGGGTGGAAGCTGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048982531 8:139710521-139710543 AGCTGGGCCTCTAGGGCAGCAGG + Intergenic
1049373783 8:142279696-142279718 AGATGGGCCAGGAGGGTGGCGGG + Intronic
1049570466 8:143368005-143368027 AGGTGGTCCTGGAGGCAAGCTGG + Intergenic
1049602222 8:143513226-143513248 AGCTGGACCTGCAGGGAAGGTGG - Intronic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049618863 8:143588893-143588915 AGGTGGGCAGGGGAGGAAGCTGG + Intronic
1049660701 8:143818596-143818618 GGGTGGGCCAGGAGGGGAGTGGG - Intronic
1049771296 8:144383233-144383255 AGGAGGGCCTGGCGGCAGGCAGG + Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050589183 9:7145049-7145071 TGGTGGGCCCAGAGGGAGGCTGG - Intergenic
1051873171 9:21762697-21762719 AGGGAGGACTGGAGGGAATCAGG + Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053176324 9:35927388-35927410 AGTCTGGCCTGCAGGGAAGCAGG + Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054456170 9:65431608-65431630 AGGTGGGCCTGGAGCTAAGGGGG - Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057141449 9:92728941-92728963 AGGTGTGCCTGGTGGGTGGCTGG - Intronic
1057221376 9:93259552-93259574 AGGTGGGGCTGGAGGGGCTCAGG - Exonic
1057489718 9:95511343-95511365 AGGAGAGGCTGGAGGGAAGGTGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057800107 9:98185790-98185812 AGGTGGGCCAGGAGAGACCCTGG + Intronic
1058381732 9:104384296-104384318 AGGTGTGGTTGGAGGGAGGCAGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059560888 9:115333631-115333653 GGGTGGTCCTGGGGGGAAGGGGG - Intronic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1060252477 9:121997389-121997411 AGGTGGGGCTGGACAGAGGCTGG - Intronic
1060277623 9:122193862-122193884 AGGGGAGCTGGGAGGGAAGCGGG + Intronic
1060389559 9:123267502-123267524 AGGGGAGCCTGCAGGGAGGCGGG - Intronic
1060556132 9:124507938-124507960 AGGGGGGCCGGAAGGGGAGCAGG + Intergenic
1060601362 9:124880365-124880387 AGGTCAGCCTGCAGGGAAGTGGG + Exonic
1060755027 9:126206356-126206378 AGCTGGGCTGGGAGGGAGGCTGG - Intergenic
1060840810 9:126791929-126791951 AGGGGAGACTGGAGGGAAGGAGG - Intergenic
1061012942 9:127966063-127966085 GGGTGGGCCGGGAGGGAGGCTGG + Intronic
1061183565 9:129038728-129038750 AGGTGAGGCTGGGGGGAAGGTGG + Intronic
1061186724 9:129059295-129059317 GGGTGGGCGTGGAGGGTGGCAGG + Intronic
1061382194 9:130265433-130265455 AGTTGGGGCTGGAGGGAGACTGG + Intergenic
1061959555 9:133981090-133981112 AGGAGGCCCTGGGGAGAAGCAGG + Intronic
1062436978 9:136550713-136550735 AGCTGGGCCTGGGGGGTGGCTGG + Intergenic
1062447172 9:136599859-136599881 AGGTGGCCCTGGAAGGCAGGCGG + Intergenic
1062485245 9:136771249-136771271 AGGTGGGCCCTGTCGGAAGCTGG + Intergenic
1062494993 9:136827452-136827474 AGGCGGGACTGGAGGGGAGCCGG - Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189322831 X:40096932-40096954 CGGTGGGCCAGGAGGAGAGCAGG - Intronic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1190233917 X:48601734-48601756 AGGAGGGCCTGGCTGGAAGCAGG + Intronic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190473231 X:50803515-50803537 AGGTAGGCCTGGGAGGAAGAAGG - Intronic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1193320912 X:80120049-80120071 AGGAGGGCAAGGTGGGAAGCAGG + Intergenic
1194826918 X:98575964-98575986 ATGTGGACTTGGAGGGAAGGGGG + Intergenic
1195160485 X:102166000-102166022 AGGTGGTCCTGAAAGGCAGCAGG + Intergenic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1197275432 X:124473732-124473754 ATGGGGGCCTGGAGGGAATGGGG - Intronic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1198816072 X:140591738-140591760 AGCTGGGGCTGGAGGGAGACAGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200090767 X:153634937-153634959 ATGTGGGCCTGGAGGAAGTCGGG + Intergenic
1200135340 X:153872000-153872022 AGATGGGCCAGGGGAGAAGCTGG + Intronic
1200746770 Y:6910483-6910505 AGCTGGGGCTGGTGGGAGGCGGG + Intergenic