ID: 1002183637

View in Genome Browser
Species Human (GRCh38)
Location 5:177443905-177443927
Sequence TGAGTACCAAACTAACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002183636_1002183637 -5 Left 1002183636 5:177443887-177443909 CCTGCTGGGGAGTGGTGCTGAGT No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183635_1002183637 -2 Left 1002183635 5:177443884-177443906 CCACCTGCTGGGGAGTGGTGCTG No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183630_1002183637 9 Left 1002183630 5:177443873-177443895 CCGCAGGACTCCCACCTGCTGGG No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183628_1002183637 12 Left 1002183628 5:177443870-177443892 CCACCGCAGGACTCCCACCTGCT No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183624_1002183637 27 Left 1002183624 5:177443855-177443877 CCTTGAGTTCCCAAGCCACCGCA No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183622_1002183637 29 Left 1002183622 5:177443853-177443875 CCCCTTGAGTTCCCAAGCCACCG No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183627_1002183637 17 Left 1002183627 5:177443865-177443887 CCAAGCCACCGCAGGACTCCCAC No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183634_1002183637 -1 Left 1002183634 5:177443883-177443905 CCCACCTGCTGGGGAGTGGTGCT No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183623_1002183637 28 Left 1002183623 5:177443854-177443876 CCCTTGAGTTCCCAAGCCACCGC No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data
1002183626_1002183637 18 Left 1002183626 5:177443864-177443886 CCCAAGCCACCGCAGGACTCCCA No data
Right 1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002183637 Original CRISPR TGAGTACCAAACTAACCACC TGG Intergenic
No off target data available for this crispr