ID: 1002186577

View in Genome Browser
Species Human (GRCh38)
Location 5:177457499-177457521
Sequence GATCTCTGTGGCGTTAGAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002186574_1002186577 -8 Left 1002186574 5:177457484-177457506 CCAGCATGTGATGTCGATCTCTG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1002186573_1002186577 -7 Left 1002186573 5:177457483-177457505 CCCAGCATGTGATGTCGATCTCT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1002186567_1002186577 24 Left 1002186567 5:177457452-177457474 CCCTCCTCCTCTTCTGGAACTGG 0: 1
1: 0
2: 2
3: 40
4: 354
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1002186571_1002186577 20 Left 1002186571 5:177457456-177457478 CCTCCTCTTCTGGAACTGGGTCT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1002186569_1002186577 23 Left 1002186569 5:177457453-177457475 CCTCCTCCTCTTCTGGAACTGGG 0: 1
1: 0
2: 3
3: 33
4: 411
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1002186572_1002186577 17 Left 1002186572 5:177457459-177457481 CCTCTTCTGGAACTGGGTCTGCA 0: 1
1: 1
2: 0
3: 18
4: 235
Right 1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002186577 Original CRISPR GATCTCTGTGGCGTTAGAAA GGG Exonic
907881542 1:58553577-58553599 GATCTCTGGGGAGTGAGCAAGGG - Intergenic
908740192 1:67319465-67319487 GATCTCTTTGGCAGTAAAAAAGG - Intronic
910264873 1:85327951-85327973 GTTCTCTGTAGCGTTTAAAAAGG - Intronic
914716927 1:150261339-150261361 CATCTGTGTGGAGGTAGAAATGG - Intronic
915165240 1:153944695-153944717 GATCTCTGTGATGTTATAACTGG - Intronic
918402375 1:184176360-184176382 GTTTTCTGTGGCTTTGGAAATGG - Intergenic
920839132 1:209539149-209539171 GGGCACTGTGGCATTAGAAAGGG - Intergenic
1065104585 10:22369550-22369572 GAGCACTGTGGCATTAGACAGGG + Intronic
1069866127 10:71503998-71504020 GATCACTAGGGCCTTAGAAATGG + Intronic
1073653470 10:105386561-105386583 GCTCTCTGAAGCCTTAGAAATGG + Intergenic
1073758163 10:106603321-106603343 GATCTCTGGTGAGTGAGAAAAGG - Intronic
1075325857 10:121531706-121531728 TAACTCTATGGCCTTAGAAAAGG - Intronic
1075974362 10:126682893-126682915 GTTTTCAGTGGTGTTAGAAATGG - Intergenic
1081843167 11:46218254-46218276 GAACTCTGTGGGGTTAGGTATGG - Intergenic
1085779482 11:79395388-79395410 GAACTCTGTGCAGTTAGGAATGG - Intronic
1090261017 11:125320273-125320295 AATCTCTGCTGTGTTAGAAAAGG - Intronic
1095127962 12:38504303-38504325 GATCTCTCTGGTCCTAGAAAGGG + Intergenic
1101304418 12:103513406-103513428 GATCTATCTGGCTTTAGACATGG - Intergenic
1104187152 12:126443883-126443905 GGTCTCTGTGGCATTAGGATAGG + Intergenic
1108172764 13:47760207-47760229 GAAAACTGTGGCATTAGAAATGG - Intergenic
1109254511 13:60062562-60062584 GATATCTGTGCCAGTAGAAAAGG + Intronic
1110419825 13:75294035-75294057 GACCTCAGTAGCCTTAGAAAGGG - Intronic
1111347786 13:86984184-86984206 TATCTCTGTGGAGTGATAAATGG + Intergenic
1111843287 13:93475586-93475608 GATCTATGTGGCTTTAGCAAGGG + Intronic
1112663156 13:101537485-101537507 GCTCACTGTGGCCTTGGAAAAGG + Intronic
1113846824 13:113396583-113396605 GAGCTCTGTGTCGTTAGGAAGGG - Intergenic
1115756651 14:36533786-36533808 GATCGCTGTGGAGTTACTAATGG - Intergenic
1119181903 14:72611027-72611049 GATCTCTGTGGAGGTAGTCAGGG - Intergenic
1119424798 14:74528361-74528383 CATCTCTGTGGCATTAGGAAAGG - Intronic
1120402398 14:84048484-84048506 GATTTTTGTGCCGATAGAAATGG - Intergenic
1120738087 14:88077759-88077781 GATCTCTTGGGTGTTAGATATGG - Intergenic
1130629685 15:85554153-85554175 CATCTCTTTGGCCTTAAAAATGG + Intronic
1131745973 15:95447630-95447652 CAGCTCTGTGGCTTTAGACAAGG - Intergenic
1132378953 15:101352590-101352612 TATCTCTGTGGCTTTATTAACGG + Intronic
1133254049 16:4505575-4505597 GAACTCTGGGGCCCTAGAAAAGG + Exonic
1137468822 16:48736167-48736189 GATCTCTGTGGCAGAGGAAAAGG + Intergenic
1137542355 16:49373579-49373601 GATCTCTGTGGAGGTAGAGGTGG + Intergenic
1139057730 16:63205978-63206000 TATCCCTATGGTGTTAGAAATGG + Intergenic
1140700833 16:77580204-77580226 GACCCCTGTGGAGTTAGGAACGG + Intergenic
1141471457 16:84241372-84241394 GCTCTCTGTGGCCTTGGCAATGG + Intergenic
1142950066 17:3471453-3471475 GACCTAAGTGGCGTTAGTAATGG + Intronic
1143045537 17:4075875-4075897 CAACTCTGTGGCAGTAGAAAAGG - Intronic
1145117412 17:20224586-20224608 GATCCCTTTGGCTTGAGAAAAGG - Intronic
1150544876 17:66145449-66145471 AATCTCTGTGACGTTGGAACAGG - Intronic
1150723545 17:67633686-67633708 GATTTCTGTGGAGTGAGACAAGG - Intronic
1153538109 18:6124873-6124895 GATCTCTATTGCTTTAAAAATGG + Intronic
1156209225 18:34920631-34920653 GGTCTCTGTGAGGTTAGAAATGG - Intergenic
1157380340 18:47208988-47209010 GATCTTTATGGCGTTATCAAGGG + Intergenic
1158964587 18:62611659-62611681 GGTCTCTGTGGCTTTAGAGTTGG - Intergenic
1159556459 18:69950909-69950931 TATCTCTGTGGCGTGTGGAAAGG - Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
926387545 2:12352106-12352128 GAATGCTGTGGCGTTAGTAAAGG + Intergenic
928271254 2:29857070-29857092 CATGTCTGTGGAGTTAGAACTGG + Intronic
930327943 2:49943908-49943930 AAGCTCTGTGTCTTTAGAAAGGG - Intronic
932336459 2:70934429-70934451 GATCTCTGTGGTGATGGAACAGG - Intergenic
936531197 2:113278098-113278120 GATCTCTGTGGAGTTAGAGGGGG - Intronic
939410296 2:141815950-141815972 GATTGCTGTAGCGTTAGGAAAGG + Intronic
939550982 2:143615380-143615402 GATATGTGTAGGGTTAGAAATGG - Intronic
940367137 2:152860831-152860853 GATGTCTGTGGCATTACTAATGG + Intergenic
940679258 2:156763525-156763547 GATCTCTGAGGAGTTAGCACTGG - Intergenic
1176104286 20:63378504-63378526 AATTTCTGTGGGGTGAGAAATGG - Intergenic
957230706 3:77510467-77510489 GACCTCTCTGGCTTTTGAAATGG - Intronic
958723585 3:97876387-97876409 GATGCCTGTGAGGTTAGAAATGG + Exonic
960254961 3:115501920-115501942 GATCTCGGTGGCTTTATAGAAGG - Intergenic
964183021 3:153910464-153910486 GATCTGTGGGGCATTGGAAAGGG + Intergenic
968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG + Intronic
969262835 4:6044407-6044429 GCTCACTGTGGCGTTAGGGAAGG - Intronic
970406894 4:15772703-15772725 GAGCTGAGTGGGGTTAGAAAAGG + Intergenic
970726132 4:19047031-19047053 AATCTCTCTGGGGTTAGAGAAGG - Intergenic
971060867 4:22967680-22967702 AATCTCTGTGGTTTCAGAAAAGG - Intergenic
980281289 4:130724282-130724304 GATATATGTGGAGGTAGAAAGGG - Intergenic
982649961 4:158075840-158075862 GATTTCTGTAGCTTTATAAATGG + Intergenic
983063824 4:163187979-163188001 GAACTGTGTGTGGTTAGAAAGGG + Intergenic
984160540 4:176247436-176247458 GATTTCTGTAGCTTTAGAATAGG - Intronic
984301947 4:177931325-177931347 AATCTCTGTGACGTTAGATTTGG - Intronic
984480527 4:180295207-180295229 GATCTCTGTGGCATTATTTATGG - Intergenic
986130088 5:4922002-4922024 GATTTCTGTGTGGTTGGAAAGGG + Intergenic
988447394 5:31302989-31303011 GATCTCAGTGTCATTAGAATTGG - Intronic
989158153 5:38364500-38364522 GAGCTCTGTGGGGTGAGAGATGG + Intronic
993886802 5:93424460-93424482 GATCTATGTGGGGTGAGAATGGG - Intergenic
998375760 5:141689525-141689547 GATCTCAGTGGCATGAGAAATGG - Intergenic
1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG + Exonic
1003737662 6:8895177-8895199 GATTTCAGTGGTGTAAGAAATGG - Intergenic
1003939740 6:11012397-11012419 GATCTGTGTTGCTTTAGAATGGG + Intronic
1007617318 6:43187739-43187761 GATCTCTGTGTCCGTGGAAATGG + Exonic
1008481344 6:51988983-51989005 AAAGTCTGTGGCTTTAGAAAAGG + Intronic
1014611078 6:123547041-123547063 GAATTCTGTAGCCTTAGAAATGG - Intronic
1015146668 6:129995094-129995116 GCTCTCTGTGGGGTTAAGAAGGG - Intergenic
1017741543 6:157411001-157411023 GATGTCTGTGGTGTTAAAGATGG - Intronic
1018918064 6:168150148-168150170 GATCTCTGTGTCCTTTGACATGG + Intergenic
1023773780 7:43583718-43583740 GTTCTCTGTGGCGTTTCGAATGG + Intronic
1024242016 7:47443028-47443050 GATCTCTGTGGTTTTGGAATTGG - Intronic
1025154634 7:56593373-56593395 GATTTGTGTGCCCTTAGAAATGG - Intergenic
1025763306 7:64415532-64415554 GATTTGTGTGCCCTTAGAAAAGG + Intergenic
1029668795 7:102014182-102014204 GACCTCTGTGGCCTTCGAAGCGG + Intronic
1030787171 7:113676141-113676163 GATCTCTGTAGTGTAAGAGATGG + Intergenic
1031444111 7:121829567-121829589 GATCTCTGAGGGGTAAGAAGTGG + Intergenic
1036039529 8:5060069-5060091 GACCTCTGTGGCTTGAGAAGGGG + Intergenic
1045383824 8:101652114-101652136 GATCTGGGTGGGGTAAGAAAGGG + Intronic
1051686020 9:19658861-19658883 GATACCTGTGGCTGTAGAAACGG - Intronic
1052670297 9:31548457-31548479 GATCTCTGCAGCTTTAGATATGG - Intergenic
1056700017 9:88895405-88895427 GTTTTCTGTGGTGTTAGAAATGG + Intergenic
1056953085 9:91061023-91061045 GATCACTGTGGTTTCAGAAATGG + Intergenic
1059907216 9:119001066-119001088 AATCTGTATGGCATTAGAAATGG + Intergenic
1187036367 X:15544541-15544563 GTTCTCTGTAGCTTTGGAAAAGG + Intronic
1188265629 X:28069884-28069906 GATTTCTATGGAGTTACAAAAGG - Intergenic
1188948740 X:36341380-36341402 AATTACTGTGGCATTAGAAATGG - Intronic
1189004768 X:36984149-36984171 TATCTCTGTGGCCTTCTAAAAGG + Intergenic
1189044246 X:37573659-37573681 TATCTCTGTGGCCTTCTAAAAGG - Intronic
1190186188 X:48236617-48236639 GATATTTGTGGTGTCAGAAATGG - Intronic
1194193842 X:90868655-90868677 GAACTGTGTGTGGTTAGAAAGGG - Intergenic
1200428056 Y:3043916-3043938 GATATCTGTGGTGATAGAACTGG - Intergenic
1200540452 Y:4451039-4451061 GAACTGTGTGTGGTTAGAAAGGG - Intergenic