ID: 1002187773

View in Genome Browser
Species Human (GRCh38)
Location 5:177462526-177462548
Sequence TGCGTTGCTCACAGCGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002187773_1002187786 4 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187786 5:177462553-177462575 GAGGACCGGGGTCTCCGGGTGGG No data
1002187773_1002187790 18 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187790 5:177462567-177462589 CCGGGTGGGTGGCCAGCACAAGG 0: 1
1: 0
2: 7
3: 14
4: 189
1002187773_1002187791 21 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187791 5:177462570-177462592 GGTGGGTGGCCAGCACAAGGCGG 0: 1
1: 0
2: 2
3: 17
4: 209
1002187773_1002187784 0 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187784 5:177462549-177462571 GGATGAGGACCGGGGTCTCCGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1002187773_1002187787 7 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187787 5:177462556-177462578 GACCGGGGTCTCCGGGTGGGTGG 0: 1
1: 0
2: 2
3: 18
4: 176
1002187773_1002187781 -9 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187781 5:177462540-177462562 AGCAACGCAGGATGAGGACCGGG No data
1002187773_1002187782 -8 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187782 5:177462541-177462563 GCAACGCAGGATGAGGACCGGGG 0: 1
1: 0
2: 1
3: 1
4: 98
1002187773_1002187785 3 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187785 5:177462552-177462574 TGAGGACCGGGGTCTCCGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 140
1002187773_1002187792 22 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187792 5:177462571-177462593 GTGGGTGGCCAGCACAAGGCGGG No data
1002187773_1002187783 -1 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187783 5:177462548-177462570 AGGATGAGGACCGGGGTCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 207
1002187773_1002187780 -10 Left 1002187773 5:177462526-177462548 CCCCCTCCGCTGTGAGCAACGCA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1002187780 5:177462539-177462561 GAGCAACGCAGGATGAGGACCGG 0: 1
1: 0
2: 0
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002187773 Original CRISPR TGCGTTGCTCACAGCGGAGG GGG (reversed) Intronic
900212743 1:1464413-1464435 TGCACTGCTCACAGCGGTGGTGG + Intronic
900220263 1:1504865-1504887 TGCACTGCTCACAGTGGTGGTGG + Intergenic
902804780 1:18854245-18854267 TGCTTTTGTCACAGCCGAGGAGG + Exonic
904289867 1:29478245-29478267 TGCGATGGACACAGCGGAGGGGG - Intergenic
904674167 1:32188031-32188053 TGCTGTGCTCACCGCGCAGGTGG - Exonic
904908042 1:33912684-33912706 TGGGGTGCTCACAGAGTAGGGGG - Intronic
917980958 1:180268772-180268794 TGCCTTGCTCACAGCCAGGGTGG - Intronic
921393261 1:214638963-214638985 TGAGTTGCTCACAGCAAAGTGGG + Intronic
1065499250 10:26362923-26362945 TGCTATGCTTACAGCAGAGGAGG + Intergenic
1076469911 10:130711108-130711130 TGCGTTGCTCGGAGGGGAAGGGG + Intergenic
1076823599 10:132955668-132955690 TGCCCTGCTCACTGCAGAGGGGG + Intergenic
1083647404 11:64180532-64180554 TGAGTTCCTCACAGCTGAGTAGG - Intergenic
1084483900 11:69437170-69437192 TGCATTGCTCACAGCCGACAGGG + Intergenic
1103989284 12:124787376-124787398 TGCGTTGGGCACAGCGTCGGGGG - Intronic
1104670380 12:130676124-130676146 TTGGTTGCTCACAGCGCTGGTGG - Intronic
1104809541 12:131612004-131612026 TGGGCGGCTCACAGCGGAGTGGG - Intergenic
1109994757 13:70108477-70108499 TGCGTCACTTACAGGGGAGGAGG - Intronic
1112750803 13:102581462-102581484 AGCCTTGCTCAGAGTGGAGGCGG - Intergenic
1117029502 14:51653082-51653104 TGCATTGCTCACAGCAGGGAAGG + Intronic
1119433584 14:74583939-74583961 TGTGTTGCTCAGAGGGCAGGAGG - Intronic
1121420554 14:93810387-93810409 TGGGTTGCTCACAGTGTAGATGG + Intergenic
1123996854 15:25724746-25724768 TGCTTTCATCACAGCGGTGGTGG - Intronic
1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG + Intergenic
1133368410 16:5229205-5229227 AGCTTTGCTCACAGTGCAGGAGG + Intergenic
1134503966 16:14790615-14790637 TGCGTTGCTCACAGTTCTGGAGG - Intronic
1134576606 16:15338293-15338315 TGCGTTGCTCACAGTTCTGGAGG + Intergenic
1135840142 16:25868779-25868801 TGCGTTCCTCACAGGGAAAGTGG + Intronic
1137773896 16:51040138-51040160 TGCGTAGCTCAGTGGGGAGGGGG + Intergenic
1142229672 16:88893936-88893958 TCCCTTGCTGACAGGGGAGGGGG + Intronic
1152498607 17:80693330-80693352 AGAGTTGCTCCCAGCGGAGATGG + Intronic
1152817831 17:82418651-82418673 GGCGGGGCTCAGAGCGGAGGCGG + Exonic
1152864195 17:82712571-82712593 TGCTCAGCTCTCAGCGGAGGGGG + Intergenic
1159926708 18:74276073-74276095 TGCCAGGCTCACAGAGGAGGTGG - Intronic
1164760870 19:30727393-30727415 TGCTCTGCACACAGCTGAGGAGG - Intergenic
1164777234 19:30862344-30862366 TACCTTGTTCACACCGGAGGGGG + Intergenic
925261695 2:2534988-2535010 GGGGATGCTCACAGCTGAGGAGG + Intergenic
925610508 2:5697207-5697229 TGCGGCGCCCGCAGCGGAGGAGG + Exonic
935367361 2:102308539-102308561 AGCGATCCTCACAGCGGAGCAGG + Intergenic
938948396 2:136235103-136235125 TGTGTGGCTCTCAGGGGAGGAGG + Intergenic
942386027 2:175444045-175444067 TGCTTTGCCCACAGTGGAGTCGG - Intergenic
948431343 2:237921118-237921140 TGCGTTTCTCGCAGCTGTGGAGG + Intergenic
1172768462 20:37363440-37363462 TGTGCTCCTCACAGGGGAGGTGG + Intronic
1174351291 20:49970204-49970226 TGCGTAGCTCACAGGCGAGGGGG - Intergenic
1174609084 20:51784394-51784416 GGCGTTATTCACAACGGAGGTGG + Exonic
1176546635 21:8205178-8205200 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1176554529 21:8249369-8249391 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1176565586 21:8388225-8388247 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1176573451 21:8432393-8432415 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1179817595 21:43917665-43917687 TGTGTGGCACACAGGGGAGGAGG + Intronic
1180137944 21:45873270-45873292 TGGGTTGCTCACAGAGGAGTGGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1182696822 22:32203864-32203886 TGCATTGCTCATGGCGGGGGAGG - Intergenic
1203251500 22_KI270733v1_random:121444-121466 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1203259550 22_KI270733v1_random:166526-166548 TGCCTAGCTCACAGCGGGGACGG - Intergenic
951558892 3:23946135-23946157 GGGGTTGCACACTGCGGAGGAGG + Intronic
954540658 3:51391349-51391371 TAGGTTTCTCACAGCGGCGGCGG - Exonic
961866498 3:129957099-129957121 AAGGTTGCTCACAGAGGAGGTGG - Intergenic
968408069 4:359444-359466 AGCGTTGATCACAGCTGAGAGGG + Intronic
971703267 4:30007761-30007783 TGTGGTGCTCACAGGGAAGGAGG + Intergenic
972660551 4:41112030-41112052 TGCTTTTCTCACAGCAGAGGTGG + Intronic
974009626 4:56594926-56594948 TGCATTCCCCACAGAGGAGGTGG + Intronic
985548960 5:523818-523840 TGCGGGGCTCGGAGCGGAGGCGG + Intronic
985987571 5:3529528-3529550 TGAGTTGCTCACAGTAGATGGGG + Intergenic
986204304 5:5609580-5609602 TGCGTGACTCACAGCAGTGGCGG + Intergenic
986310742 5:6549245-6549267 AGCAATACTCACAGCGGAGGCGG + Intergenic
986334929 5:6747307-6747329 GGCCTTGCACACAGCAGAGGAGG - Intronic
991629302 5:68638779-68638801 TGTTTTGCTCAAAGCGGAGTTGG - Intergenic
993922481 5:93824167-93824189 TTCGTTGCTCACAGCTATGGAGG - Exonic
999032771 5:148312603-148312625 TGAGATGCTCACATCGCAGGAGG - Intronic
999730566 5:154473938-154473960 TGCGGCGCTCACTGCGAAGGAGG - Intergenic
999938092 5:156509927-156509949 TGCCTTGCTCACAGGTGAAGGGG - Intronic
1002187773 5:177462526-177462548 TGCGTTGCTCACAGCGGAGGGGG - Intronic
1004119879 6:12810679-12810701 TGCCCTGCTCATAGCTGAGGTGG + Intronic
1011662867 6:89609215-89609237 TGCCTGGCTCACAGCTCAGGAGG + Intronic
1018182963 6:161240646-161240668 TGCGGTGCCCACAGAGGAGAGGG + Intronic
1018790824 6:167146368-167146390 TGCGCTGCTCCCAGCGCAGAGGG + Intergenic
1038835471 8:31116554-31116576 TCCGTTGCTCATAGTGGAAGTGG + Intronic
1039137965 8:34348411-34348433 TGTGTTGCTGTCAGCGGTGGTGG + Intergenic
1040943541 8:52856973-52856995 TAAGTTGCTCACAGCGAAGCCGG + Intergenic
1050276748 9:4008634-4008656 TGAGTTGCTCACAGTCTAGGTGG - Intronic
1053057356 9:35001494-35001516 TTCCTTGCTCACAGTTGAGGAGG + Intergenic
1203467902 Un_GL000220v1:104595-104617 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1203475723 Un_GL000220v1:148567-148589 TGCCTAGCTCACAGCGGGGACGG - Intergenic
1192621762 X:72683109-72683131 TGTGTTGGTCACAAAGGAGGAGG + Intronic
1193374183 X:80738607-80738629 TGCTGTGCACACAGTGGAGGGGG + Intronic