ID: 1002188441

View in Genome Browser
Species Human (GRCh38)
Location 5:177466859-177466881
Sequence GGCCCCCGGGCGCACCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002188441_1002188452 1 Left 1002188441 5:177466859-177466881 CCGTCAGGGTGCGCCCGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1002188452 5:177466883-177466905 CTGGAGCGCTCCGGGCGGGCAGG 0: 1
1: 0
2: 2
3: 24
4: 216
1002188441_1002188446 -7 Left 1002188441 5:177466859-177466881 CCGTCAGGGTGCGCCCGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1002188446 5:177466875-177466897 GGGGGCCCCTGGAGCGCTCCGGG 0: 1
1: 0
2: 0
3: 29
4: 299
1002188441_1002188447 -4 Left 1002188441 5:177466859-177466881 CCGTCAGGGTGCGCCCGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1002188447 5:177466878-177466900 GGCCCCTGGAGCGCTCCGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 186
1002188441_1002188445 -8 Left 1002188441 5:177466859-177466881 CCGTCAGGGTGCGCCCGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1002188445 5:177466874-177466896 CGGGGGCCCCTGGAGCGCTCCGG 0: 1
1: 0
2: 2
3: 19
4: 218
1002188441_1002188448 -3 Left 1002188441 5:177466859-177466881 CCGTCAGGGTGCGCCCGGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1002188448 5:177466879-177466901 GCCCCTGGAGCGCTCCGGGCGGG 0: 1
1: 0
2: 3
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002188441 Original CRISPR GGCCCCCGGGCGCACCCTGA CGG (reversed) Intronic
900394751 1:2448696-2448718 GGCCCCCTGGCGCAGCCTCCTGG + Intronic
900569327 1:3350655-3350677 GGGCCCTGGGAGCACCCAGAAGG + Intronic
900736296 1:4301449-4301471 AGCCCCCGTGCACACCCTGTGGG - Intergenic
901407133 1:9056877-9056899 GGCCCTCGGGCAGACCCGGAAGG - Intronic
902573111 1:17359477-17359499 GGCACCCGGGCGGTCCCAGAGGG + Intronic
903853454 1:26321710-26321732 GGTCCCAGGGCGCCCTCTGATGG + Intergenic
906052707 1:42888011-42888033 GGCCTCCGGGCCCACAATGAAGG + Intergenic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
915074419 1:153296908-153296930 GTCCCCCAAGAGCACCCTGAAGG - Intergenic
915367300 1:155323445-155323467 GGCCGACGGGCGCCCCCTGTTGG + Intronic
915879996 1:159659454-159659476 GGCCCCCGAACTCACACTGAAGG - Intergenic
919464378 1:197912287-197912309 GGCGTCCGGGCGCACTCCGAGGG - Intronic
922925479 1:229343329-229343351 CGCCCCCGGCCGCAGCCTGGGGG - Intergenic
1063600458 10:7475793-7475815 GACCGCAGAGCGCACCCTGACGG + Intergenic
1067266234 10:44747967-44747989 GGCCCACGGCCGCACCCAGGTGG + Intergenic
1067849724 10:49746971-49746993 GCCCTCTGGGCCCACCCTGAAGG + Intronic
1069532614 10:69230323-69230345 GGCTCCCGGGCTCACCCCCAAGG - Intronic
1070802076 10:79249765-79249787 GGCCCGCGGGCCTACCCTGTTGG + Intronic
1072538148 10:96378774-96378796 GGCCCCCAGGTGCCTCCTGAAGG + Intronic
1073537583 10:104291631-104291653 GCCCCTCGGGCGCCCCCAGAGGG - Intronic
1077335507 11:2002022-2002044 GGCCCCAGGTCACACTCTGAGGG - Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1084318965 11:68362889-68362911 TGCCCCCAGGCCCACCCTCAGGG + Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1087672913 11:101128182-101128204 GGCGCCCGGGCGCTCCCCGCTGG - Exonic
1090780695 11:130003461-130003483 GGCGCCCGGCCGCTCCCTGGGGG - Intergenic
1202818491 11_KI270721v1_random:57204-57226 GGCCCCAGGTCACACTCTGAGGG - Intergenic
1094485983 12:30926531-30926553 GGCTCCCGGGCGCGTCCTGCCGG + Intronic
1103565269 12:121812135-121812157 GGCCCGCGGGCGCCCCCTGCTGG + Intronic
1104966346 12:132510244-132510266 GGCAGCCGGGCCCACCCTGCCGG + Intronic
1105725697 13:23160276-23160298 GGCCCCCGAGCGCGCCCGGCTGG - Intergenic
1107931472 13:45311219-45311241 GGCGCCCGGGCGCCCCCTCCCGG + Intergenic
1112175432 13:97018775-97018797 GGGCCCTGTGCTCACCCTGAAGG + Intergenic
1112621602 13:101058975-101058997 GGCCTCCTGGAGCACCCTGCTGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114529623 14:23387743-23387765 GGACCCCCAGCACACCCTGAAGG + Exonic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1119157361 14:72423313-72423335 GGCCCTCAGGCTCACGCTGATGG + Intronic
1119195317 14:72713387-72713409 GGGCCCAGGGAGCACCCTGGGGG - Intronic
1121599710 14:95194251-95194273 GGACCCCGCGCGCACCCAGAAGG - Intronic
1122625673 14:103084321-103084343 GGGCCCCGGGAGCGCCCTGACGG + Intergenic
1123134122 14:106011815-106011837 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123168508 14:106349176-106349198 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123197051 14:106627142-106627164 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123222825 14:106872723-106872745 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1124248997 15:28095288-28095310 GTCCCCCGGGCGCACCCGGGCGG - Intronic
1126140105 15:45430454-45430476 GACTCCCGGGCGCCCCCTGCAGG - Intergenic
1128830422 15:70763423-70763445 GGCCCCCGCGCGAACCTTAAAGG + Exonic
1129717974 15:77862878-77862900 CGCCCCCGGCTGCAGCCTGATGG - Intergenic
1129788327 15:78323687-78323709 GGTACCCGGGCCCACGCTGAGGG + Intergenic
1132674218 16:1114998-1115020 GGGCCTCAGGTGCACCCTGAAGG + Intergenic
1132994745 16:2817199-2817221 GGGCCCGGGGCGCCCCCTGGGGG - Intronic
1133040954 16:3059466-3059488 GGCCCGCGGCCTCACCCGGAGGG + Exonic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1136497482 16:30653040-30653062 GGCCCCCCAGCCCACCCTGGTGG + Exonic
1136594913 16:31241574-31241596 GGACCCAGGTCCCACCCTGATGG - Intergenic
1138557948 16:57783889-57783911 GGGTCCAGGGCCCACCCTGAAGG - Intronic
1139673987 16:68510331-68510353 GAGCCCCGGGCGCCCCCTGCAGG + Intergenic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1141639409 16:85332829-85332851 GGCCCCTGGGCCCGCCATGAAGG - Intergenic
1141841979 16:86579278-86579300 GGCCCGCGGGCGCTGCCTGCAGG - Exonic
1142030588 16:87836483-87836505 AGGCCCCGGGCTCACCTTGATGG + Exonic
1142132225 16:88436332-88436354 GGCCCCCGGCCTCAGCCTGTGGG + Exonic
1142429751 16:90019577-90019599 GGCCCGCGCGCGCCCCCTGCTGG + Intronic
1145017116 17:19406468-19406490 AGCCCCCAGCAGCACCCTGAGGG + Intergenic
1145093978 17:20009221-20009243 GGCCCCCGGCCGCCGGCTGAAGG + Intergenic
1147168822 17:38606502-38606524 GGCTCCCCGGCGCCCCCTGCTGG + Intergenic
1149265141 17:54920247-54920269 GGCCCACGGGCATACTCTGATGG + Intronic
1150124680 17:62628275-62628297 GCTCCCCGGGCGCGCCCTGCAGG - Intronic
1151969771 17:77451593-77451615 GGCCGCGAGGCGGACCCTGATGG + Intronic
1152552022 17:81034821-81034843 GGGCCCTGGGAGCAGCCTGAGGG - Intergenic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1160021536 18:75185358-75185380 GGAGCCCGGGCTTACCCTGAAGG + Intergenic
1160411002 18:78675415-78675437 GGTCCCCTGGCACACCCCGATGG + Intergenic
1160556862 18:79731100-79731122 TGCCCCCGGGTGCTCCCTGGAGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160792536 19:929343-929365 GGCCGCCGGGCTCAAGCTGAAGG - Exonic
1161223863 19:3133269-3133291 GCCCCCTGGGCTCACCCTGTGGG + Intergenic
1161232036 19:3179226-3179248 GGCCACCGGCCGCACCATGGTGG - Exonic
1162112064 19:8404707-8404729 GGCCTGCGGGCGTCCCCTGATGG + Intronic
1165787970 19:38473676-38473698 CGCCCCCGGGGGCACCCCGCAGG + Exonic
1166705034 19:44903775-44903797 GGCCCTCTGGCGCCCCCTGCAGG - Intergenic
1167136408 19:47618787-47618809 GGCCACCAGGCGCTCCCTCAAGG - Intronic
1167578509 19:50329035-50329057 GGCCCCCTGGCGCCCGCGGAAGG + Exonic
928303500 2:30147231-30147253 AGCGCCGGGGCCCACCCTGAAGG - Intronic
934716987 2:96550140-96550162 GGCCGGCGGGCGCCCCCTGGCGG - Intronic
934949018 2:98563640-98563662 AGGCCCCGGGAGCACCCCGAGGG + Intronic
937854404 2:126661915-126661937 GCACCCCTGGCACACCCTGATGG + Intronic
940517269 2:154698036-154698058 GGCCCTCCGGCGGACCCTCAAGG - Intergenic
942446075 2:176079981-176080003 CGCCCCGGGGCGCCCCCTGGCGG + Exonic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
948123234 2:235546272-235546294 GGCCCTCGGGTGCCACCTGATGG + Intronic
948482602 2:238259641-238259663 GGCTCCCAGGCACACCCTGCTGG + Intronic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1170656004 20:18288456-18288478 CGCCACCAGGCGCGCCCTGAAGG - Exonic
1171312206 20:24153621-24153643 GGCCCAGGCGTGCACCCTGATGG - Intergenic
1172037387 20:32019402-32019424 TGCCCTCGGGCTCACCCTGTTGG - Exonic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1173820168 20:46014294-46014316 GGCGCCCGGGCTCCCCCTGCCGG - Intronic
1175230691 20:57471523-57471545 GCCCCCCGGGCCCACTCAGAAGG - Intergenic
1175429005 20:58889782-58889804 GGCCCCCGTGCGCCCCGTGTCGG - Intronic
1175925419 20:62468932-62468954 TGCCCCCTGCCACACCCTGATGG + Intronic
1175983874 20:62754761-62754783 GGCCGCCTGGCGTACCATGACGG - Exonic
1176380482 21:6110314-6110336 GGGCCCCGGGCGGACGCTGCGGG - Intergenic
1179742990 21:43427926-43427948 GGGCCCCGGGCGGACGCTGCGGG + Intergenic
1180041447 21:45282313-45282335 GCCCCCCGGGAGCAGCCTGGAGG - Intronic
1180056946 21:45363874-45363896 GGCCCCCGGCCGCAGCATGAAGG - Intergenic
1180154894 21:45972964-45972986 GCCCCCAGAGCCCACCCTGAAGG - Intergenic
1180898206 22:19352767-19352789 TGCCCCATGCCGCACCCTGAAGG + Intronic
1181806376 22:25376843-25376865 TGCCCCCAGGCCCACCCTCAGGG - Intronic
1182445584 22:30387493-30387515 GGGCCGCGGGCGCCCCCTGGTGG + Intronic
1183058317 22:35320285-35320307 GGCCCCCACTTGCACCCTGAAGG - Intronic
1183315514 22:37135014-37135036 GGCCCCGGGGCTCTCCCTGGAGG + Intronic
1183371883 22:37437392-37437414 GGCCCCCAGGCCCATTCTGATGG - Intergenic
1184837696 22:47033741-47033763 GCGCCCCGGGCTCACCCTCATGG - Intronic
1185254189 22:49823128-49823150 GGCCTCCGGGTGCAGCCTGGAGG + Exonic
950501365 3:13365931-13365953 GGGCCCCTGGCTCACCTTGAGGG + Exonic
953356909 3:42263808-42263830 CGCCCCCGGGCGCACCTGGCTGG + Intronic
953771248 3:45779994-45780016 GGCCCCCCGGCTCACCTGGAAGG + Exonic
954386419 3:50246352-50246374 GGCTGCCGGGCGCCCCCTGGTGG + Intronic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
955341675 3:58130002-58130024 GACCCCCCGGGGGACCCTGAGGG - Intronic
961012922 3:123448145-123448167 AGCACCCGGGCGCCCCCTGCGGG - Exonic
961306116 3:125959814-125959836 GGTACCCAGGCGCACCCTGCCGG + Intergenic
961446121 3:126982645-126982667 GGAGCCCGGGCGCCCCCTGCAGG - Intergenic
961778945 3:129310155-129310177 TGCCTCCTGGCCCACCCTGATGG - Intergenic
968235914 3:197029896-197029918 GGCCCCGGCGCGCCCCCTGCTGG + Intergenic
968603214 4:1520182-1520204 CGCCGCCGGGCCCGCCCTGATGG + Intergenic
968819952 4:2843343-2843365 GGCCCCCGGGCCCGGCCTGCGGG - Intergenic
980969576 4:139556186-139556208 AGCCGCCGGGAGCACCCAGAGGG - Exonic
983552436 4:169031570-169031592 GGCCACCGCACGCACCCTGGAGG + Intergenic
983552447 4:169031604-169031626 GGCCACCGCACGCACCCTGGAGG + Intergenic
985558431 5:569485-569507 GGCCCCGGGGCCCTCTCTGATGG + Intergenic
985571237 5:646685-646707 GGCCCCTGGCCTCACCCTCATGG + Intronic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
987090564 5:14505266-14505288 GGCCTCCGGCCGCTCCCTGCCGG - Intronic
989568506 5:42924475-42924497 GGCCACCGGGCTCAGCCTGGAGG + Intergenic
993380039 5:87196255-87196277 AGCCTCCTGGCCCACCCTGAAGG - Intergenic
996308331 5:122076831-122076853 GGCACCAGAGCGCCCCCTGAAGG + Intronic
998805760 5:145916471-145916493 GGCCCCAGGCTGAACCCTGAGGG + Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1004511977 6:16290632-16290654 GACCCCGGGGCGCACCCTCGAGG + Intronic
1005763635 6:28989553-28989575 GGCCACCGCACGCAGCCTGAAGG + Intergenic
1006936210 6:37720346-37720368 GGCACCTGGTCGCACCCTGACGG - Intergenic
1010043861 6:71419397-71419419 TGCCCCCGGGCGATCCCTGCCGG - Intergenic
1011272589 6:85594163-85594185 AGCCGCCGGGCGCTGCCTGAGGG + Intronic
1016915626 6:149241921-149241943 GGCCCCCAGGAGCAGCCTTACGG - Intronic
1017000147 6:149990902-149990924 GGCCGCTGGGCGCTCCCTGCGGG - Intergenic
1018980578 6:168598891-168598913 GGCCGCCGTGCGCACACTCAGGG - Exonic
1019277087 7:181501-181523 GGCCCTCGGGTCCACTCTGAAGG + Intergenic
1020181016 7:5922505-5922527 GGCCCCAGGGTGGACACTGAGGG + Intronic
1020301917 7:6802383-6802405 GGCCCCAGGGTGGACACTGAGGG - Intronic
1021653587 7:22854120-22854142 GGCCCTCGCGCGCCCCCTGTCGG - Intergenic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1026841296 7:73671218-73671240 GGCCCCCGGGCGGCCCCAGTGGG - Exonic
1034468937 7:151245617-151245639 GGCCCATGGGCGCCCCCTGGTGG + Exonic
1035021457 7:155803387-155803409 GGCCCCAGTGCGCCCCCGGAAGG + Exonic
1036632662 8:10526141-10526163 GGCCCCCCAGAGCTCCCTGATGG + Intronic
1040859468 8:51984213-51984235 GGCCCCGGGGTGCACTCAGAAGG - Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057477000 9:95411502-95411524 AGACCCCGGGCGCACCCGCATGG + Intergenic
1057571474 9:96207309-96207331 GGCCCCCGGACACAGCCTCAGGG + Intergenic
1058990969 9:110255585-110255607 GGCCCCCGGGCCCAACCTTGGGG + Intronic
1061047999 9:128177736-128177758 GGGCGCCGGGGGCTCCCTGAAGG - Exonic
1061509588 9:131052542-131052564 GTCCCCGGGGGGCACCCGGAAGG - Exonic
1062631474 9:137464974-137464996 GGGCCCCAGGCCCACCCAGAAGG - Intronic
1196785843 X:119420819-119420841 GGCCACCAGGCCCAGCCTGAAGG - Intronic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1199991624 X:152990547-152990569 GCCCCCCGGCCTCTCCCTGATGG + Exonic
1200222380 X:154397570-154397592 GACCCCCAGACGCACCCGGAGGG + Intronic