ID: 1002189977

View in Genome Browser
Species Human (GRCh38)
Location 5:177473133-177473155
Sequence CCCGGGGCCGCGTGGCCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002189977_1002189989 5 Left 1002189977 5:177473133-177473155 CCGCAGGGCCACGCGGCCCCGGG 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1002189989 5:177473161-177473183 CATCGGGACCCCGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 96
1002189977_1002189988 4 Left 1002189977 5:177473133-177473155 CCGCAGGGCCACGCGGCCCCGGG 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1002189988 5:177473160-177473182 ACATCGGGACCCCGCGCCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1002189977_1002189993 15 Left 1002189977 5:177473133-177473155 CCGCAGGGCCACGCGGCCCCGGG 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1002189993 5:177473171-177473193 CCGCGCCTCCGGGCCGCGTCCGG 0: 1
1: 0
2: 0
3: 20
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002189977 Original CRISPR CCCGGGGCCGCGTGGCCCTG CGG (reversed) Exonic