ID: 1002193137

View in Genome Browser
Species Human (GRCh38)
Location 5:177489260-177489282
Sequence TCTCAGCTGGAGTAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002193137_1002193150 24 Left 1002193137 5:177489260-177489282 CCCTACTCCTACTCCAGCTGAGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1002193150 5:177489307-177489329 GCAGCTGAGGCAAGACAGGTGGG 0: 1
1: 0
2: 3
3: 25
4: 346
1002193137_1002193148 20 Left 1002193137 5:177489260-177489282 CCCTACTCCTACTCCAGCTGAGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1002193148 5:177489303-177489325 AGTCGCAGCTGAGGCAAGACAGG 0: 1
1: 0
2: 0
3: 14
4: 173
1002193137_1002193142 11 Left 1002193137 5:177489260-177489282 CCCTACTCCTACTCCAGCTGAGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1002193142 5:177489294-177489316 ATTCCCCCCAGTCGCAGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 93
1002193137_1002193149 23 Left 1002193137 5:177489260-177489282 CCCTACTCCTACTCCAGCTGAGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1002193149 5:177489306-177489328 CGCAGCTGAGGCAAGACAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002193137 Original CRISPR TCTCAGCTGGAGTAGGAGTA GGG (reversed) Intronic
900499844 1:2998646-2998668 ACACAGCTGGAGCAGGAGGAGGG + Intergenic
902420254 1:16273397-16273419 TTTCAGATGGAGCAGGACTAAGG + Intronic
903793911 1:25913997-25914019 ACACAGCTGGAGGAGGATTAGGG - Intergenic
904913157 1:33950366-33950388 TCTCTGCTGGAGGAGAAATAAGG - Intronic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905517736 1:38574482-38574504 TCCCAGGTGGAGTTGGGGTAGGG + Intergenic
906320439 1:44812368-44812390 TCTCAGCTTGACTTGGGGTAGGG + Intronic
906607203 1:47180891-47180913 GCTCAGGTGGAGGAGGAGAAAGG + Intergenic
908656760 1:66396268-66396290 TCTCAGCTGGAGAATTAGCAAGG - Intergenic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
909564789 1:77042295-77042317 GCTCTGCTGAAGTCGGAGTAAGG - Intronic
910242137 1:85098817-85098839 TCTGAGTTGGAGTAAGAATAAGG + Intronic
910430917 1:87159016-87159038 TCTCAGCAGCTGGAGGAGTAAGG - Intronic
912544246 1:110439589-110439611 CCTCAGCTGGAGTAGTGGTGGGG + Intergenic
915168020 1:153959369-153959391 TCTGGGCTGGGGTAGGAGGAAGG - Exonic
915570262 1:156741472-156741494 TCTCTGCTGGAGTGGGGGCAGGG + Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
919281574 1:195496206-195496228 TACCAGCTGCAGTAGTAGTAGGG + Intergenic
919712819 1:200745256-200745278 TCACAACTGGGGTAGGAGTAGGG - Intronic
920258458 1:204672761-204672783 TATCAGCTGGAAGAGGAGCAAGG - Intronic
923102429 1:230827063-230827085 TCACAGTTGGGGTAGGAGTGGGG - Intergenic
923255240 1:232216350-232216372 TCTCAACTGGGGCAGGAGCATGG - Intergenic
923277712 1:232413059-232413081 TCTAAGCTGAAGTAAGAGTATGG - Intronic
1064847392 10:19670555-19670577 TGGAAGCTGGAATAGGAGTAGGG - Intronic
1065603196 10:27390940-27390962 CCTCAGCTGCAGTACAAGTAGGG - Intergenic
1066027336 10:31373839-31373861 TCTCAGTGGGAGTATGTGTAAGG - Intronic
1066459616 10:35601728-35601750 TCTCAGCTGGGGTGGAAGCAGGG + Intergenic
1068672186 10:59734356-59734378 TCTCAGGGGGACTAGGATTATGG + Intronic
1069560257 10:69424225-69424247 TCCCAGCTGGTGAAGGAGCAGGG - Intergenic
1069613718 10:69792728-69792750 TCAGAGGTGGAGCAGGAGTAGGG - Intergenic
1070746858 10:78939016-78939038 CCACCCCTGGAGTAGGAGTAGGG + Intergenic
1072663023 10:97374090-97374112 TCTCTGGGGGAGTAAGAGTATGG - Intronic
1073782869 10:106858501-106858523 TCCCAGCTGAGGTAGGAGAATGG + Intronic
1074166341 10:110879546-110879568 TCCCAGCTGGGGCAGGAGAATGG + Intronic
1076441092 10:130481846-130481868 TCCCAGCTGGAGAAGCAGAATGG + Intergenic
1076682933 10:132184217-132184239 TTTGAGCTGGAGAAGGACTATGG + Exonic
1078438063 11:11341791-11341813 TTTCAGCTGAAGAAGGAGTTGGG - Intronic
1079117251 11:17647707-17647729 TGTCAGCTGTGGTAGGATTAAGG + Intergenic
1080535905 11:33221381-33221403 TAGGAGCTGGAGTAGGAGTTAGG + Intergenic
1083171904 11:60928132-60928154 CCCCATCTGGAGTTGGAGTAAGG + Intronic
1083594068 11:63910780-63910802 TCTGAGCCGCAGTAGGAGTGTGG - Exonic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1086573023 11:88306634-88306656 TCTCAGCCAGAGAAGGAGGATGG - Intronic
1088568123 11:111194831-111194853 TCTCAGGTTGAGTAGGATTTAGG - Intergenic
1088817939 11:113434093-113434115 TCTGAGCTGGAGTGGCAGGAAGG - Intronic
1090213658 11:124941438-124941460 ATTCAGCTGAAGCAGGAGTATGG + Intergenic
1090236895 11:125154856-125154878 TCTGAGCTGGAGCAGGCGTGAGG - Intergenic
1091167260 11:133490753-133490775 TCTCTGCTGATGTAGGATTATGG - Intronic
1091265871 11:134270625-134270647 TCTCAGCTGGGGTGGGAATTGGG - Intergenic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1092535989 12:9387819-9387841 TCTCTGCTGAAGTGGGAGAATGG + Intergenic
1093026611 12:14251218-14251240 CCTTACCTGGATTAGGAGTATGG - Intergenic
1095784093 12:46090997-46091019 TCTCAAGTGAACTAGGAGTATGG + Intergenic
1095830356 12:46579197-46579219 TCTCAGCTGAGGCAGGAGGAAGG - Intergenic
1096011095 12:48215993-48216015 GCTCAGCTGGAGAAGGGATAGGG + Intergenic
1096598461 12:52713165-52713187 TCTCATCTGGGGTAGGGGTAGGG + Intergenic
1098590107 12:72201114-72201136 TCTCTCCTGGAGTAGAACTAGGG + Intronic
1098659292 12:73072552-73072574 TGTCAGCTGGGGTAGGATAACGG + Intergenic
1099323524 12:81181285-81181307 TCTCACCTGGAGAAGCTGTATGG + Intronic
1099669061 12:85667738-85667760 TGGCACCTGGAGTAGAAGTATGG - Intergenic
1101694835 12:107115365-107115387 TCTCAGCTGAACTTGGGGTATGG - Intergenic
1107540188 13:41382164-41382186 TCCCTGGTGGATTAGGAGTAGGG - Intergenic
1108673148 13:52711983-52712005 TCTCAGCTGTGCTAGGAGAAAGG + Intronic
1113146060 13:107208886-107208908 TCTCTGCTGGAGGGGGAGGAGGG - Intronic
1116609917 14:47055402-47055424 TCTGAGCTGGATTAAGAATAAGG - Intronic
1116962108 14:50977304-50977326 GCTCTGCTGGAGTAGAAGTCGGG + Exonic
1117872032 14:60211136-60211158 TCTAAGCTGGTGTGGGAGAAGGG - Intergenic
1118091407 14:62484330-62484352 TCTCAGCAGGAGAAGGATCAAGG - Intergenic
1118347169 14:64948717-64948739 TTGCAGCTGGCGAAGGAGTATGG - Exonic
1118383820 14:65239064-65239086 TCTCAGCTGGTGGAGGACTTGGG + Intergenic
1119438336 14:74612136-74612158 GCCCAGCTGGAGTAGGAGCGCGG - Exonic
1119760389 14:77146664-77146686 TCTCTGCTGGGGTAGGGGGAGGG - Intronic
1119851016 14:77866828-77866850 CCTGGGCTGGACTAGGAGTAGGG + Intronic
1120470542 14:84918295-84918317 TCTTAGATGGAGTAAGAGGAAGG - Intergenic
1126187475 15:45844411-45844433 TCTCAGCTGAAGTGGTAGTAAGG - Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1128563049 15:68681291-68681313 TCTCAGTGGGAGCAGGAGTTGGG + Intronic
1132070739 15:98774977-98774999 GCCCAGCTGGAGAAGGAGTCTGG - Intronic
1132953652 16:2579184-2579206 TCACAGCTGGAGCAGGGGTACGG + Intronic
1132960699 16:2620983-2621005 TCACAGCTGGAGCAGGGGTACGG - Intergenic
1133298446 16:4767067-4767089 TCTCGGCGGGAGTAGGACTGCGG + Exonic
1133315967 16:4884254-4884276 TTCCAGCTGGAGTCGGAGCAGGG + Exonic
1133728130 16:8556074-8556096 TCTCAGATGAAATATGAGTATGG - Intergenic
1134739767 16:16532046-16532068 TCTCTGCAGGAGTTAGAGTAAGG - Intergenic
1134824215 16:17271715-17271737 TGTCTCCTGGAGTAGGAGTGGGG + Intronic
1134927731 16:18180106-18180128 TCTCTGCAGGAGTTAGAGTAAGG + Intergenic
1135698255 16:24609703-24609725 CCCCAGCTGCAGTAGGAGTCAGG - Intergenic
1140481105 16:75263356-75263378 TCTCAGCTGCAGGAAGAGTCAGG + Intronic
1140605327 16:76529657-76529679 TCTCACCTGGAGGAGAAGTAAGG + Intronic
1141001581 16:80313208-80313230 TCTCTCCTGGAGTGGGAGTGGGG - Intergenic
1146541219 17:33697078-33697100 CCAGAGCAGGAGTAGGAGTAGGG - Intronic
1146585489 17:34078333-34078355 TAACAGGTGGAGTAGGAGCAAGG - Intronic
1147931284 17:43983272-43983294 ACGCAGCTGGAGTAGGAGACAGG + Intronic
1148624989 17:49062446-49062468 TCCCAGCTAGAGCAGGAGGATGG + Intergenic
1149047539 17:52265350-52265372 TCTCATCTGCAATGGGAGTATGG - Intergenic
1153294249 18:3530665-3530687 TCTCAGCAGCAGTGGGAGCAGGG - Intronic
1154052536 18:10974640-10974662 TCTCAGCTGGAGTCTGAGCACGG - Intronic
1155000997 18:21686773-21686795 CCCCAGCTGGAGTGGGAGAAAGG - Intronic
1157490606 18:48121117-48121139 TTTCAGCTGGAGTAGAAGCCTGG - Intronic
1157561094 18:48646835-48646857 TCACTCCTGCAGTAGGAGTAGGG + Intronic
1159061085 18:63514517-63514539 TCTCAGCTGCAGCAGGAGAGGGG - Intergenic
1159861842 18:73659018-73659040 TCTCAGATGTAGTAGGCGGAGGG + Intergenic
1159886093 18:73908833-73908855 CTTCTGGTGGAGTAGGAGTAAGG - Intergenic
1161443991 19:4307764-4307786 TCTCACCTGGAGTTCGAGAAGGG + Intronic
1161979027 19:7620997-7621019 GCACAGCTGGAGGAGGAGTGGGG - Exonic
1163228420 19:15980688-15980710 TCTCAGCTGGGGCTGGAGTCTGG - Intergenic
1165958257 19:39515395-39515417 TCTGGGCTGGAGCAGGAGTCAGG - Exonic
1165959165 19:39520149-39520171 TCTCAGCTGGATGATGAGAAGGG + Exonic
1167380401 19:49134899-49134921 TGTCACCTGGAGTAGGAGGATGG - Exonic
927947992 2:27148916-27148938 TCTCAGCTGGGTTAGGAGGCAGG + Intergenic
928158014 2:28894486-28894508 TCTGGGCGGGAGTGGGAGTATGG - Intergenic
928936633 2:36685830-36685852 TCTTACCTGGGGTAGGAGTGTGG - Intergenic
932812678 2:74837416-74837438 TCTCAGCTGGAGTAGCCAGAGGG - Intronic
933073059 2:77886774-77886796 TATAAGCGGGAATAGGAGTAGGG - Intergenic
935631635 2:105216965-105216987 TCCTACCTGGAGTAGGAGTGTGG + Intergenic
937560524 2:123218792-123218814 ACTCAGCTGTAGTAGAAATAGGG + Intergenic
938278346 2:130047950-130047972 TCTCTGTTGGTGTTGGAGTATGG - Intergenic
938329319 2:130438809-130438831 TCTCTGTTGGTGTTGGAGTATGG - Intergenic
938360628 2:130682694-130682716 TCTCTGTTGGTGTTGGAGTATGG + Intergenic
938437030 2:131289402-131289424 TCTCTGTTGGTGTTGGAGTATGG + Intronic
941468113 2:165854430-165854452 TATCAGCTGTAGTAGCAGCAGGG + Intergenic
942737900 2:179137376-179137398 TCTAACCTGGAGAAAGAGTATGG + Intronic
946327547 2:218992597-218992619 CCTCAGCTGGGGCAGGGGTAGGG + Intronic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
1169397885 20:5250973-5250995 TACCAGCTGCAGTAGTAGTAGGG + Intergenic
1169432318 20:5548860-5548882 TCACAGGGGGATTAGGAGTAGGG - Intronic
1170331711 20:15219368-15219390 TTACAGCAGGAGTAGGAGCAGGG - Intronic
1171383807 20:24753434-24753456 TCACAGCTGGAGTGAGAGCATGG + Intergenic
1173524639 20:43722138-43722160 TGTCAGCCAGGGTAGGAGTATGG + Intergenic
1174582539 20:51582288-51582310 TCTTAGCTAGAGTAAGAGTTGGG - Intergenic
1175156660 20:56976141-56976163 GGTCAGATGGAGGAGGAGTATGG + Intergenic
1175713744 20:61241623-61241645 TCACAGCTGGAGGAAGAGTCAGG - Intergenic
1182124653 22:27807647-27807669 TCTCAGTTGGGGTAGGTTTAGGG + Intergenic
1183839429 22:40485803-40485825 TCTAAGATGGAGGAGGAGCAAGG + Intronic
1184235780 22:43182330-43182352 TCCCAGCTGGAGGAGGAGGCGGG + Intronic
1184286322 22:43473694-43473716 TCTCAGATGGAGTAGGGGGCAGG + Intronic
949280176 3:2336778-2336800 TCTCATGTGGATCAGGAGTAAGG + Intronic
953208503 3:40853322-40853344 TCTCAGCTGGAGTCTGATTTAGG - Intergenic
953243322 3:41168629-41168651 TTTCAGCTGGAGTTGGAGGAGGG - Intergenic
953921164 3:46952810-46952832 TCTCATCTGTGGTAGGAGAAAGG - Intronic
954701085 3:52451222-52451244 ACTCAGCTGGAGTTGGAGGCTGG + Exonic
959066282 3:101660326-101660348 TATCAGGTGGAACAGGAGTAGGG + Intronic
960874323 3:122282116-122282138 TCTCGGCTGCAGTTGGAGAAGGG - Exonic
960910713 3:122646494-122646516 TTTCTCCTGGAGTAGGAGAAAGG - Intergenic
962199535 3:133390074-133390096 TCCCAGCTGGAGTAAGTGTATGG - Intronic
963205074 3:142625464-142625486 CCTCAGCTGGAGCAGGTATAGGG - Intronic
963590372 3:147249814-147249836 TCTCAGCTGAGGCAGGAGAATGG - Intergenic
964880507 3:161418024-161418046 TCTCAGCTGGATCAGGAGATTGG - Intergenic
965816788 3:172644349-172644371 TCAAATCTGGAGTAGGAGCAAGG + Intronic
966062315 3:175773002-175773024 TTTCAGCTGGGGTAGGATTTAGG + Intronic
967703289 3:192619852-192619874 TTTCAGCTGGAGCAGAAGAATGG + Intronic
969374192 4:6752432-6752454 TCTCAGCTGAGGCAGGAGGATGG + Intergenic
971046457 4:22810589-22810611 ATTCAGCTGGAGTTGGAGTGGGG + Intergenic
971764184 4:30808008-30808030 TCTTAGCTGGTGTAGGAGGCAGG + Intronic
974993285 4:69121208-69121230 TCTCTGCAGGAGTAGAAGAATGG + Intronic
978424464 4:108567672-108567694 TGTTTGCTGGAGTTGGAGTATGG - Intergenic
978429694 4:108620696-108620718 TTTGAGCTGGTGTAGGGGTAAGG + Exonic
982664359 4:158243411-158243433 TGTCAGTTGGAGTAGTGGTAGGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985709439 5:1420022-1420044 TCTCAGCTGGGGTATGAGGCAGG - Intronic
986238437 5:5934566-5934588 GGTCAGCTGATGTAGGAGTAGGG - Intergenic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
988043659 5:25919796-25919818 TATCAGCTGGAGAAGCATTAGGG - Intergenic
990011059 5:50998664-50998686 ACTCAGCTGGATTAGGAGGCAGG - Intergenic
994174810 5:96700072-96700094 TCTCATCTGTAATAGGAGTGAGG + Intronic
998232886 5:140372793-140372815 AATTAGCTGGAGTAGGAGTCTGG + Exonic
1002193137 5:177489260-177489282 TCTCAGCTGGAGTAGGAGTAGGG - Intronic
1003957309 6:11175609-11175631 TCCAAGCAGAAGTAGGAGTAAGG - Intergenic
1004363817 6:14995382-14995404 CCTCGGCTGGGGTAGGAGTGAGG - Intergenic
1005058807 6:21757175-21757197 TGTCGGCTGGAGTGGGGGTAAGG + Intergenic
1005911544 6:30314335-30314357 TCTGAGCTGGAGGAGGACAAAGG - Intergenic
1006046325 6:31301812-31301834 ACTCAGCTGGTCTAGGAGTTTGG + Intronic
1010268745 6:73896787-73896809 GCTCAGCTGGAATAGGAGAGGGG + Intergenic
1012567001 6:100669922-100669944 TCACAGATGAAGTAGGTGTATGG + Intronic
1012900883 6:105004852-105004874 TCTGGACTGGAGCAGGAGTATGG - Intronic
1018783190 6:167087606-167087628 TCTCAGCTGAAGAAAGATTAAGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1022645737 7:32227244-32227266 GCCCAGCTGGAGAAGGAGCAGGG + Intronic
1027953492 7:84850412-84850434 TCTCATCTGGAGTCTCAGTAAGG + Intergenic
1031467649 7:122133361-122133383 CCTCAGCTGGAGTAAGCATAGGG + Intronic
1033355508 7:140595860-140595882 TGGCAGCTGGAGGAGGAGGATGG - Intronic
1033501446 7:141954468-141954490 GGTCAGCTGGAGCAGGAGTCAGG + Intronic
1039794885 8:40904322-40904344 TCTGTGCTGGAGAAAGAGTAAGG - Intergenic
1044577123 8:93782021-93782043 TCCCAGCTGAAGCAGGAGAATGG - Intronic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1048855910 8:138686434-138686456 TCTCAGATGGAGCAGAGGTAAGG + Intronic
1049218663 8:141418957-141418979 TCTCACCTGGGGCAGGGGTAGGG + Intronic
1052799280 9:32952664-32952686 ACACAGCTGGAGCAGGAGCAGGG + Intergenic
1052862237 9:33444187-33444209 TTTCAGCAGGCGTAGGTGTAGGG + Intronic
1053546883 9:39032542-39032564 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1053811202 9:41854195-41854217 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1054619392 9:67333244-67333266 TCTCAGGTGGAATTGGAGGAGGG - Intergenic
1055839677 9:80488180-80488202 CCTCAGCTGTAGTACAAGTAGGG - Intergenic
1057455413 9:95204699-95204721 TTTTAGATGGAGTAGGGGTAAGG - Intronic
1058596245 9:106618729-106618751 TCTCAGTTGGAGGAGTAGCAGGG - Intergenic
1058797207 9:108510481-108510503 ACTCAGCTGCAGTAGGGATAAGG - Intergenic
1059560481 9:115329911-115329933 GCGCAGATGGAGTAGGAGTTAGG - Intronic
1185644742 X:1608837-1608859 TCTTAGCTGGAGTAGGCGCAGGG - Intergenic
1185645149 X:1610560-1610582 TCTTAGCTGGAGTAGGGGCAGGG - Intergenic
1188491740 X:30745259-30745281 TCTCAGCTGGAGTAGTAACCAGG + Intergenic
1190246597 X:48695011-48695033 ACTCTGCTCGAGAAGGAGTAAGG + Intergenic
1196182978 X:112715374-112715396 GCTCAGCTGGAGTGGGAGTGGGG - Intergenic
1197904658 X:131412286-131412308 TGCCAGCTGGAGTAGGAGGTAGG - Intergenic
1198514067 X:137386747-137386769 CCTCAGGTGGAGTATGACTATGG - Intergenic
1199320591 X:146433543-146433565 CCTCTGCTGGTGAAGGAGTAGGG + Intergenic
1199526936 X:148803385-148803407 ACTCAGCTGGGGTATGAGTCTGG + Intronic
1200119103 X:153782029-153782051 GCCCAGCTGGAGCAGGAGAAGGG + Intronic