ID: 1002194908

View in Genome Browser
Species Human (GRCh38)
Location 5:177496483-177496505
Sequence CCCCTCCAGCACTACTTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002194896_1002194908 14 Left 1002194896 5:177496446-177496468 CCTTGCCCCCTTGCAGCCGGAAG 0: 1
1: 1
2: 1
3: 16
4: 188
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194900_1002194908 6 Left 1002194900 5:177496454-177496476 CCTTGCAGCCGGAAGCCCCAAGG 0: 1
1: 1
2: 2
3: 14
4: 170
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194899_1002194908 7 Left 1002194899 5:177496453-177496475 CCCTTGCAGCCGGAAGCCCCAAG 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194903_1002194908 -2 Left 1002194903 5:177496462-177496484 CCGGAAGCCCCAAGGTGCTGGCC 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194905_1002194908 -10 Left 1002194905 5:177496470-177496492 CCCAAGGTGCTGGCCCCTCCAGC 0: 1
1: 0
2: 0
3: 24
4: 208
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194897_1002194908 9 Left 1002194897 5:177496451-177496473 CCCCCTTGCAGCCGGAAGCCCCA 0: 1
1: 0
2: 4
3: 23
4: 160
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194898_1002194908 8 Left 1002194898 5:177496452-177496474 CCCCTTGCAGCCGGAAGCCCCAA 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1002194904_1002194908 -9 Left 1002194904 5:177496469-177496491 CCCCAAGGTGCTGGCCCCTCCAG 0: 1
1: 0
2: 1
3: 24
4: 191
Right 1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002194908 Original CRISPR CCCCTCCAGCACTACTTTGA AGG Exonic
901177213 1:7313076-7313098 ACCCCCCAGAACTACTATGAAGG + Intronic
901956981 1:12793457-12793479 CCCTTCCAGCAATGCTTTTAAGG - Exonic
901980377 1:13029593-13029615 CCCTTCCAGCAATGCTTTTAAGG - Intronic
901989058 1:13097720-13097742 CCCTTCCAGCAATGCTTTTAAGG + Intergenic
901992755 1:13129047-13129069 CCCTTCCAGCAATGCTTTTAAGG - Intergenic
902001710 1:13199338-13199360 CCCTTCCAGCAATGCTTTTAAGG + Intergenic
902020938 1:13345063-13345085 CCCTTCCAGCAATGCTTTTAAGG + Exonic
913538287 1:119795239-119795261 CCACTCCAGCACTGCTTTTGAGG + Intronic
916188330 1:162154534-162154556 CCCCTCCAGCCCTACCTAGAAGG - Intronic
916971934 1:170029494-170029516 CCCATTAAGCACTTCTTTGATGG - Intronic
918424036 1:184390007-184390029 TCCTTCCAGCTCTACTTTGAGGG + Intronic
919562308 1:199137079-199137101 CCTCTCTAGCACTTCTTTGATGG + Intergenic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
920390127 1:205594807-205594829 CACCTCCATCCCTTCTTTGATGG + Intronic
921049014 1:211497799-211497821 GCCCTTCAGCACTACTTTTGGGG - Intergenic
922574408 1:226652499-226652521 CCCCTCCAGCCCTCCCTTGTGGG + Intronic
923997259 1:239509480-239509502 CAACTCCAGCTCTACCTTGAGGG - Intronic
1065332822 10:24620586-24620608 CCCCAACCGCACTACTTTGCAGG - Exonic
1069718746 10:70537051-70537073 CCCCTGGAGCACTGCTGTGAGGG + Intronic
1069847715 10:71384322-71384344 CTCCCCAAGCCCTACTTTGAAGG - Intergenic
1072224151 10:93352190-93352212 CCCCTGCTGCATAACTTTGAGGG + Intronic
1075921253 10:126215256-126215278 CCCCACCAGCACTACTGACAGGG + Intronic
1081027680 11:38035906-38035928 CCTCTCCAGCACTACTTCTGTGG - Intergenic
1085572418 11:77571100-77571122 CCCCTCCAGAACAAGGTTGAAGG + Intronic
1090007811 11:123018282-123018304 CACCTCCAGCGCTTCTTTAACGG - Intergenic
1095986958 12:48005123-48005145 CCCATCCAGCTCTGCGTTGAAGG + Intergenic
1097853999 12:64442607-64442629 TCCCATCAGAACTACTTTGAAGG + Intronic
1098376898 12:69825542-69825564 GCCCTGCAGCAGTTCTTTGAAGG + Exonic
1098701233 12:73630074-73630096 CCACTCCAGCAATACTCTGCTGG + Intergenic
1101750045 12:107576086-107576108 CCCCTACTGCACTAGGTTGAAGG + Intronic
1103266244 12:119632916-119632938 CCCTTCCAACACTTCTTGGATGG - Intronic
1105429383 13:20323642-20323664 CATCTCAAGCACTACTTTCATGG - Intergenic
1106092906 13:26614493-26614515 CACCTAAAGCACTACTTTAAGGG + Intronic
1107574321 13:41701021-41701043 TCACTCCAGCCCTACTTTCATGG + Intronic
1117607172 14:57441567-57441589 GCCCTACAGTACTACTTTGAGGG - Intergenic
1118651191 14:67896808-67896830 TCCCTCCAGCTTTACTTGGAAGG - Intronic
1118656001 14:67949542-67949564 ACCCTCATGGACTACTTTGAAGG - Intronic
1119442393 14:74637125-74637147 CCCCTGCAGCCCTGCTTAGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124060441 15:26289183-26289205 CCCTTCAGGCAGTACTTTGAAGG + Intergenic
1128568187 15:68714854-68714876 CCGCTCCAGCTCACCTTTGAAGG - Intronic
1133000848 16:2850694-2850716 CCTCTCCAGCCCTCCTTTGCTGG - Intergenic
1133228602 16:4355305-4355327 CTCCCCCAGGACTCCTTTGAAGG - Exonic
1136008474 16:27347166-27347188 CTCCACCAACACTACTGTGAAGG - Intronic
1137365386 16:47855481-47855503 TTCCTCCAGCCCCACTTTGAAGG - Intergenic
1137708638 16:50551478-50551500 CCCCTGCATAACAACTTTGATGG - Intronic
1140171923 16:72614188-72614210 CTCCTCAAACACTAATTTGAAGG + Intergenic
1142621857 17:1170309-1170331 CCCCACCAGCACCGCTGTGAAGG + Intronic
1147190057 17:38733267-38733289 CCCCACCAGCCCTTCTGTGACGG + Exonic
1147865524 17:43549537-43549559 ACCCTCCAGCACATCTTTGGTGG + Intronic
1149083606 17:52687230-52687252 CTCCTACAGCTCTACTTAGAGGG - Intergenic
1156953626 18:42935494-42935516 CCCATCCAGCACTTATTAGATGG + Intronic
1160324992 18:77937839-77937861 CTCCTTCAGGACAACTTTGAGGG - Intergenic
1163118720 19:15202999-15203021 TCCCTCCAGCTCAACTTTCAGGG - Intergenic
1165303198 19:34985749-34985771 CTCCTCCAGCACTGCTTTCCTGG + Intergenic
1165779715 19:38425480-38425502 CACCCCCAGCACCACTCTGATGG - Intronic
1167467789 19:49659217-49659239 CCCCTCCAGCCCCACGTGGAGGG + Intergenic
925388864 2:3482325-3482347 CCCCTGCAGCTCTGCTTTGCCGG - Intronic
925767112 2:7246852-7246874 CACCTCCAGAACTACGCTGAAGG - Intergenic
945273048 2:207961022-207961044 CCTCTTCAACACTATTTTGAGGG - Intronic
1168808045 20:684431-684453 CCCCTACAGCCCTACTTAGCAGG - Intergenic
1171251591 20:23653158-23653180 CTCCTCCAGCACTATGGTGAGGG + Intergenic
1172752390 20:37259783-37259805 CCACTCCAAAACTAATTTGATGG - Intronic
1182514111 22:30843180-30843202 ACCCTCCAGGATGACTTTGAGGG - Intronic
1185004056 22:48265073-48265095 CCCCTGCTGCTCTACTCTGAGGG + Intergenic
949718607 3:6962768-6962790 CCCCTCCTTCACTGCTTTGGTGG - Intronic
950118581 3:10467155-10467177 ACCCTCAACCTCTACTTTGATGG + Intronic
950668925 3:14513681-14513703 CACCTCCAGCACGACCTTGTGGG + Exonic
955339635 3:58115562-58115584 CCACTCCAGCATTACTTCAAAGG - Intronic
960012562 3:112849435-112849457 CCCCACCAACATTACTTTGCTGG + Intergenic
963288623 3:143463651-143463673 CTCCTCCAGCATTATTTTGGAGG - Intronic
965595636 3:170408191-170408213 ACCCTCCTGCATGACTTTGAGGG + Intergenic
968877103 4:3277075-3277097 CTCCTCCATCGCTACTTTCATGG + Intergenic
970597654 4:17614768-17614790 ACCTTCCAGCAGTACTTTGGTGG + Exonic
971234808 4:24831179-24831201 CTCCTCCAGCTCTTCTTTTAGGG - Intronic
979959249 4:126997053-126997075 CTCCTCATTCACTACTTTGATGG + Intergenic
981017411 4:139988365-139988387 TCCCACCATTACTACTTTGAAGG + Intronic
982065956 4:151654616-151654638 CCCCTCTAGATCTACCTTGAAGG + Intronic
983104660 4:163671553-163671575 CCACTCCATCACTACTTACAAGG - Intronic
983784947 4:171718780-171718802 CCCCACCCCCACCACTTTGATGG + Intergenic
985564761 5:609899-609921 CCCCTCCTGCAAGACTGTGAAGG - Intergenic
989670517 5:43911198-43911220 CCTCTCCAGCACCTCTCTGATGG + Intergenic
990309847 5:54527372-54527394 CCCCTCCAGCTATATTTTGGAGG + Intronic
991714228 5:69436734-69436756 GCCTTCCTGCACTCCTTTGACGG - Intronic
995190089 5:109310544-109310566 GCCTTACAGCACTGCTTTGATGG + Intergenic
996126553 5:119731999-119732021 CCCCTCCAGCCCTGCTCTCACGG - Intergenic
997222034 5:132177326-132177348 CAGCTCCAGCTCTACTTAGATGG - Intergenic
1000240458 5:159403946-159403968 CCCCTCCAGCACTCCTTGCCTGG + Intergenic
1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG + Exonic
1012027761 6:94019676-94019698 CCCTTCCATCTCTACTTTGGTGG + Intergenic
1016909224 6:149180706-149180728 ATTCTCCAACACTACTTTGATGG + Intergenic
1017579193 6:155842600-155842622 CCACTCCTGCATTACTGTGATGG - Intergenic
1020548839 7:9572194-9572216 GCCCTCCAGAATAACTTTGAAGG - Intergenic
1026968692 7:74455052-74455074 CCCCTCCAGCACTGCCAGGAGGG - Intronic
1028714705 7:93951849-93951871 CTCTTCCAGTCCTACTTTGATGG + Intergenic
1031642989 7:124188769-124188791 CCCCTCCAGCACTAGCAGGAGGG - Intergenic
1031946793 7:127850578-127850600 CCCTTCCTGCCCTGCTTTGAAGG + Intronic
1032196019 7:129789000-129789022 CCCCTCCAACCCTACTTCAATGG + Intergenic
1036439731 8:8770860-8770882 CCCTTCCATCTCTACTTTGTTGG + Intergenic
1036990165 8:13583524-13583546 ACCCTCCTGGATTACTTTGAGGG - Intergenic
1037108447 8:15137985-15138007 CCCCTCCGGGACTGCTTTCATGG - Intronic
1038423819 8:27451763-27451785 CCCCTCCTGCATTAGTTTGGAGG + Intronic
1061570505 9:131475120-131475142 CTCCTCCACCACCACTTTGGAGG + Exonic
1062104739 9:134748712-134748734 ACCCAGCAGCACTGCTTTGAGGG + Intronic
1190260548 X:48794125-48794147 CACCACCAGCACTACTGTGGTGG + Exonic
1190745376 X:53319321-53319343 CCCCTCCAGCTCAGATTTGATGG - Intronic
1191713572 X:64178148-64178170 TCCCTTGAGCACTACTTTCAGGG - Intergenic