ID: 1002197826

View in Genome Browser
Species Human (GRCh38)
Location 5:177510665-177510687
Sequence GCCACAGTGGGCACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002197826 Original CRISPR GCCACAGTGGGCACAGAGCT GGG (reversed) Intronic
900150702 1:1178136-1178158 TCCAGGCTGGGCACAGAGCTCGG - Intronic
900151750 1:1181974-1181996 CCCCCAGTGCACACAGAGCTGGG + Intronic
900208399 1:1441254-1441276 GCCACGGGATGCACAGAGCTGGG - Exonic
901769943 1:11524922-11524944 GAGATAGTGGGCACAGAGATGGG - Intronic
903162870 1:21502330-21502352 GCCCCAGAGAGCACAGGGCTGGG + Intergenic
903524970 1:23986830-23986852 GCCCCAGAGAGCACAGGGCTGGG + Intergenic
903540532 1:24093832-24093854 GCCTCCCTGGGCTCAGAGCTGGG + Intronic
904028820 1:27521376-27521398 GCCAGTGTGGGCCCAGAGCCAGG + Intergenic
904354617 1:29930946-29930968 TCCACAGAGGACACAGTGCTTGG - Intergenic
904383302 1:30125613-30125635 TCCACACTGGGCTCAGAGATGGG + Intergenic
904562623 1:31408948-31408970 GCCACAGGGGGCCAGGAGCTGGG - Intergenic
904812227 1:33170897-33170919 GCCTCACAGGGCACAGAGCCTGG + Intronic
904894151 1:33801559-33801581 TCCACAGTTAGCACAGTGCTGGG - Intronic
905645588 1:39623093-39623115 GGCACAGTGGAGCCAGAGCTGGG - Intergenic
906201266 1:43961889-43961911 GCCACAGTGAGTAGAGGGCTAGG - Intronic
906309204 1:44740990-44741012 GCCACAAAGGGCAAAGAGGTAGG + Exonic
906710628 1:47927205-47927227 GGCACAGTGGCCCCAGGGCTGGG + Intronic
907431438 1:54414412-54414434 GCCCCCGTGGGCACAGTGCAGGG + Intergenic
908495004 1:64685939-64685961 GGCAGGGTGGGCACAGAGGTAGG - Intronic
908924030 1:69231380-69231402 GCCACAGTTGGCTCAGAGAAAGG - Intergenic
910500272 1:87882510-87882532 GCCACAGTGGGGCCCTAGCTGGG - Intergenic
912385296 1:109268453-109268475 GCAACAGTGAGCACAGAGGGAGG + Intronic
913113202 1:115674214-115674236 TCCACAGTGGGGGCAAAGCTGGG - Intronic
913965838 1:143377015-143377037 GTCAGAGTGGGCACAGTCCTGGG + Intergenic
914060212 1:144202623-144202645 GTCACAGTGGGCACAGTCCTGGG + Intergenic
914118938 1:144763746-144763768 GTCACAGTGGGCACAGTCCTGGG - Intergenic
917450152 1:175141362-175141384 GCCACAGTGGGGACACAACCAGG + Intronic
918407133 1:184222508-184222530 GCCAGAGTGGGCATGGGGCTTGG - Intergenic
918495451 1:185130822-185130844 GCCACACTGGGGACAGAGACTGG - Intronic
919630530 1:199956235-199956257 GCCCCAGTGTGGACAGAGCTGGG - Intergenic
919662259 1:200258754-200258776 CCCACGGGAGGCACAGAGCTTGG - Intergenic
919845709 1:201640866-201640888 CCCACTGTGTGCACAGAGCTGGG + Intronic
920306181 1:205019616-205019638 GACACAGTGGCCATTGAGCTGGG + Exonic
921219531 1:212963321-212963343 GCCCCAGTGGGCAGGGGGCTGGG - Intronic
922422412 1:225468654-225468676 ACCATCGTGGGCTCAGAGCTGGG - Intergenic
922620982 1:226987989-226988011 GACACACTGGACACTGAGCTGGG + Intergenic
922947580 1:229530138-229530160 GCAAAAGTGGGAGCAGAGCTCGG + Intronic
923873408 1:238020649-238020671 GCCACTGTGGGCTCAGGGTTAGG - Intergenic
924666015 1:246072376-246072398 GCCACAGTGAGCACAGTGGAAGG - Intronic
1063160755 10:3416403-3416425 GCCACAGTGGGAACAGGACCTGG + Intergenic
1063954746 10:11255641-11255663 GTCACAGTGGGGAGAGAGCTGGG + Intronic
1065429594 10:25639963-25639985 TCCTCACTGTGCACAGAGCTGGG - Intergenic
1066733044 10:38450814-38450836 GTCACAGTGGGGCGAGAGCTGGG + Intergenic
1067184007 10:44011846-44011868 GCCAGCGTGGGCACCGGGCTGGG + Intergenic
1067698911 10:48554747-48554769 GCCCCTGTGGGAACTGAGCTAGG + Intronic
1069689913 10:70343626-70343648 GGCACTGTGGGCTCAGAGTTTGG + Intronic
1069905576 10:71730393-71730415 GCCACAGTGGGCCAAGCCCTGGG + Intronic
1071026844 10:81124772-81124794 GTCCAAGTGGGCACAGAACTTGG - Intergenic
1072856341 10:98951509-98951531 GCCACATTGTGCACAGGGCCAGG + Intronic
1073238372 10:102036575-102036597 GCCCCAGAGAGCACAGGGCTGGG - Intronic
1073565049 10:104527897-104527919 GCCACTGGGGGCTCAGAGCAGGG - Intergenic
1074798905 10:116979037-116979059 GCCACAGTGGGTGCAGCTCTGGG - Intronic
1075092485 10:119451455-119451477 GCAACAGAGGGCACTGAGCCAGG - Intronic
1075713403 10:124542653-124542675 GCCCCAGGGTGCACAGGGCTGGG - Intronic
1075959840 10:126558848-126558870 CCAAGAGTGGGCACTGAGCTGGG - Intronic
1077133046 11:984166-984188 GCCGCATTGGACACAGAGATGGG + Intronic
1077147628 11:1053051-1053073 GCCACAGAGGGCACAGGCCGGGG + Intergenic
1077453360 11:2663976-2663998 CCCAAAGTGGGCAGAGAGCTTGG - Intronic
1077561280 11:3263298-3263320 GCCACAGTGGGAACAGGACCTGG - Intergenic
1077567176 11:3309127-3309149 GCCACAGTGGGAACAGGACCTGG - Intergenic
1079427948 11:20361814-20361836 GGCACAGTAGGCACAGTTCTGGG + Intergenic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1081638172 11:44734736-44734758 CCCACAGTGGGTTCAGGGCTGGG + Intronic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1083904256 11:65659928-65659950 GCCACAGTGGAGTCAGTGCTGGG - Intronic
1083963309 11:66026462-66026484 GCCACAGTCTGCATTGAGCTTGG - Exonic
1085533949 11:77207156-77207178 CCTCCTGTGGGCACAGAGCTGGG - Intronic
1086140043 11:83487914-83487936 GGGATAGTGGGCACAGAGATTGG + Intronic
1086208940 11:84294769-84294791 GCCACACTGGGCTCTGAGCTTGG + Intronic
1088224353 11:107603302-107603324 GCCAAGGTGGGCACATCGCTTGG + Intronic
1088716729 11:112555449-112555471 CCCACAGTGGGCACTGAACAAGG - Intergenic
1089337130 11:117733087-117733109 GACAGAGAGGGCCCAGAGCTCGG + Intronic
1089535311 11:119157317-119157339 GCCACACTGGCCACTAAGCTGGG - Intronic
1089727641 11:120496648-120496670 GCTACAGTGGAAACAGAGCAAGG - Intergenic
1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG + Intronic
1090653330 11:128824887-128824909 GCCACAGGGGGCCGAGGGCTGGG + Intergenic
1090975082 11:131673209-131673231 ACCCCAGTGGGCACACAGCAAGG - Intronic
1092095235 12:5836739-5836761 ACCTCAGTGTGAACAGAGCTTGG - Intronic
1092185357 12:6475100-6475122 GCCGCAGAGAGCACAGGGCTGGG + Intergenic
1092209421 12:6636566-6636588 GGCCCTGTGGGCACAGGGCTGGG + Intergenic
1097226456 12:57479311-57479333 GGCATAGAGGGCACAGAGCTGGG + Exonic
1097839212 12:64304771-64304793 TCCACTGTGGGGACCGAGCTGGG + Intronic
1098485028 12:71010628-71010650 GACACAGTTGGCCCACAGCTTGG - Intergenic
1101348001 12:103904159-103904181 GCCACACTGGGAACTGAGCAGGG - Intergenic
1102038699 12:109786921-109786943 GCCAGGGTGGGCCCAGAACTAGG + Intronic
1103058007 12:117836691-117836713 GCCACAGTTGGCAAGGGGCTGGG - Intronic
1103967133 12:124646966-124646988 GCCCCAGGGGACACAGAGCCAGG - Intergenic
1104094880 12:125548045-125548067 GACACAGTGGGCTCAGAGGATGG - Intronic
1104418993 12:128619659-128619681 GGCACAGTGGGGACAGCGCAGGG - Intronic
1104849947 12:131868094-131868116 GCCACAAAGGGCTCAGAGCCAGG - Intergenic
1104927553 12:132321598-132321620 GCCACAGTGGGCCCTGGGGTTGG - Intronic
1104930313 12:132335950-132335972 ACCACAGTCGTCACAAAGCTGGG - Intergenic
1106784029 13:33089486-33089508 GCTCCTGTGGGCACACAGCTGGG - Intergenic
1107826514 13:44333290-44333312 GGCACAGTGAGCACTGGGCTTGG + Intergenic
1108228813 13:48317521-48317543 GCCACAGCGGGCACCGAGGCCGG - Intronic
1108431144 13:50355037-50355059 ACCACAGTAGGCACAGGGCCAGG - Intronic
1109651697 13:65336297-65336319 ACTGCAGTGGGCACAGAGCCAGG + Intergenic
1111420631 13:88005797-88005819 TGCACAGTTGGCTCAGAGCTAGG + Intergenic
1113849578 13:113410511-113410533 GCCACAGTGTGCTGCGAGCTGGG + Intergenic
1114716302 14:24829052-24829074 GGCACAGGGGGCACAGGGCCTGG - Intronic
1116409242 14:44601933-44601955 GCCCCAGAGAGCACAGGGCTGGG - Intergenic
1118718371 14:68576262-68576284 GCCCCAGGGGTCACAGAGCAGGG + Intronic
1118773875 14:68961539-68961561 GCCACACGGGGCACAGGGCGCGG + Intronic
1119543414 14:75455467-75455489 GCCACCTGGGGCACAGAGCAGGG - Intronic
1119729253 14:76940496-76940518 GCTACAGTGGGCCCACAGCCTGG + Intergenic
1120918029 14:89727335-89727357 GCCACAGTGGCCACAGCCCAGGG - Intergenic
1121441170 14:93950422-93950444 GGCAAAGAGGGCAAAGAGCTGGG + Intronic
1121687196 14:95845317-95845339 GCCACAGTGGGGCCTGGGCTGGG - Intergenic
1121720174 14:96103808-96103830 CCCACACTGGGTACACAGCTTGG - Intergenic
1121781359 14:96624416-96624438 CTCACAGTGAGCACGGAGCTGGG - Intergenic
1122133326 14:99618746-99618768 GCCGGTGTGGGCACAGAGCAGGG + Intergenic
1122269036 14:100560142-100560164 GCCACTGGGGCCACTGAGCTTGG + Intronic
1122935392 14:104953616-104953638 GCCACAGAAGACACAGAGCAGGG - Exonic
1123701665 15:22918658-22918680 GGCACAGCGGGCACAGGGCGTGG + Intronic
1124086514 15:26555450-26555472 ACAACAGTGGCCACAGCGCTGGG - Intronic
1125070382 15:35546691-35546713 GCCACAGAGGGCCTAGAGGTGGG - Intergenic
1127963957 15:63910181-63910203 GCCAGAGCCGGCACAGGGCTTGG + Intronic
1128254575 15:66187374-66187396 GCCCCAGTGGACAGGGAGCTGGG - Intronic
1128578615 15:68793057-68793079 GCCCCAGGATGCACAGAGCTGGG - Intronic
1129228034 15:74181139-74181161 GCCACAGGAGGCACAGCGCAGGG + Intronic
1129273288 15:74430601-74430623 GACAGAGGGGTCACAGAGCTTGG + Intronic
1129759384 15:78120728-78120750 CCCAAAGTTGCCACAGAGCTGGG + Intronic
1130912945 15:88283497-88283519 CTCAGAGTGGGCAGAGAGCTTGG - Intergenic
1132027557 15:98416234-98416256 GCCACAGTGGGTACACACTTGGG - Intergenic
1132286649 15:100668445-100668467 GCCACAGGGGGCTCAGGGCCAGG - Intergenic
1132579660 16:679230-679252 ACCGCAGAGGGCACACAGCTCGG + Intronic
1132660113 16:1057560-1057582 GCCACAGTGGGTCCTGAACTGGG - Intergenic
1132860769 16:2070698-2070720 GCCACAGTGGGTGCAGAGGAGGG - Intronic
1133754260 16:8750851-8750873 GCCACTGTGGTCACACAGATGGG - Intronic
1133969805 16:10559370-10559392 GCCACAGTGAGCATGGAGCTGGG - Intronic
1134168300 16:11948059-11948081 GCCATAGTGGGCAGAGAAGTAGG - Intronic
1134519021 16:14910033-14910055 GCCACCTTGGAGACAGAGCTTGG + Intronic
1134554907 16:15156191-15156213 GCCACCTTGGAGACAGAGCTTGG - Intergenic
1134706691 16:16308688-16308710 GCCACCTTGGAGACAGAGCTTGG + Intergenic
1134960849 16:18403436-18403458 GCCACCTTGGAGACAGAGCTTGG - Intergenic
1136031490 16:27506445-27506467 TCCCCAGGGGGCTCAGAGCTGGG + Intronic
1138027118 16:53530796-53530818 GGCACAGTGGGCTCTGAGCCTGG - Intergenic
1138196908 16:55058729-55058751 GCCTCCCTGGGCACAGAGCAAGG - Intergenic
1138448214 16:57077864-57077886 CCCGCAGTGGGCACAGGGCAGGG + Intronic
1139115783 16:63949998-63950020 GCCACAGTGGGGAAGGAGTTAGG + Intergenic
1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG + Exonic
1139557980 16:67724714-67724736 GCCTCACTGGGCCCACAGCTGGG - Exonic
1139959626 16:70710164-70710186 GCCACAGAGGGGCCAGAACTTGG + Intronic
1140540615 16:75753407-75753429 GCCCCAGTGGGCACAGGGGAAGG - Intronic
1140846462 16:78893284-78893306 GCCACAGTAAGCACAGAGTCAGG + Intronic
1140930489 16:79623119-79623141 CCCACAGTGGGAAGGGAGCTGGG + Intergenic
1141903557 16:87008143-87008165 GCCCCTGTGGGCACAGCGGTGGG + Intergenic
1141968767 16:87465530-87465552 TCCACAGTGGCCACACATCTAGG + Intronic
1142137402 16:88457902-88457924 ACCACAATCGGCCCAGAGCTGGG - Intronic
1142212742 16:88816223-88816245 GAGACAGTGGGCACAGGGCAGGG - Intronic
1142571867 17:879889-879911 ACCACAGTGGGCACTGTGGTTGG - Intronic
1142638064 17:1270205-1270227 CCCACAGCGGCCCCAGAGCTAGG + Intergenic
1143404414 17:6667745-6667767 GCCACAGAGGGCATTTAGCTTGG + Intergenic
1144959009 17:19034405-19034427 GCTGCTGTGGGCACAGAGCCCGG - Intronic
1144976150 17:19140119-19140141 GCTGCTGTGGGCACAGAGCCCGG + Intronic
1146671546 17:34741351-34741373 GTCACAGTGGGAACAAAGCCAGG + Intergenic
1146731157 17:35194771-35194793 GCCCCAGAGAGCACAGGGCTGGG + Intergenic
1147260796 17:39208912-39208934 CCCAGAGTGGGCACAGAGGAGGG + Intergenic
1147388560 17:40095835-40095857 TCCACTGTGGGCTCAGGGCTTGG + Exonic
1147643959 17:42022667-42022689 GCCTCAGTGGTCAGAGAGTTTGG + Intronic
1147659412 17:42109369-42109391 GTCCAAGTTGGCACAGAGCTGGG + Exonic
1148161115 17:45450705-45450727 GCCAGAGAAGGCACAGAGCTTGG + Exonic
1148196852 17:45720217-45720239 GGAACAGTGGGCACAGAGTCAGG + Intergenic
1149144913 17:53478792-53478814 GCCACTCAGGGCACAGAGCAGGG + Intergenic
1149468730 17:56899420-56899442 GTCTCAGAGGCCACAGAGCTGGG - Intronic
1149498340 17:57132937-57132959 GCCAGAGTGGGGACACAGGTTGG - Intergenic
1150392349 17:64797351-64797373 GCCAGAGAAGGCACAGAGCTTGG + Intergenic
1150411010 17:64940616-64940638 GCCAGAGAAGGCACAGAGCTTGG - Intergenic
1153832673 18:8937061-8937083 GCCACAGTGGGAAGGGAGGTTGG - Intergenic
1155716148 18:28946103-28946125 TCCAAAGTGGGTAAAGAGCTTGG + Intergenic
1156485925 18:37465597-37465619 CCCACTGTGTGCCCAGAGCTGGG + Intronic
1157572289 18:48721076-48721098 CCAACTGTGGGCACAGAACTAGG - Intronic
1157609258 18:48946064-48946086 GACACAGAGGGCTCAAAGCTAGG - Intronic
1158471745 18:57743228-57743250 ACCACAGAGAGCACAGAGCTGGG - Intronic
1158668735 18:59455753-59455775 GCCACCTTTGGCACAGACCTTGG - Intronic
1158822903 18:61181335-61181357 ACCACTGTGGACACAGACCTTGG + Intergenic
1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG + Intergenic
1160383641 18:78479715-78479737 GGCACAGTGGGCAGAGGGCACGG - Intergenic
1160419992 18:78737425-78737447 ACCTCAGTGCACACAGAGCTGGG + Intergenic
1160915868 19:1496228-1496250 CCCACCAGGGGCACAGAGCTGGG + Intronic
1160959500 19:1713045-1713067 GCCTCCCTGGGCACAGAGCAGGG + Intergenic
1161078949 19:2300871-2300893 GCCCCAGTGTTCACAGAGCCTGG - Intronic
1161093384 19:2374936-2374958 GCACCAGGGGGCACAGAACTTGG + Intergenic
1161138134 19:2632884-2632906 GCCACAGTGGGCTCTGCACTGGG + Intronic
1161159301 19:2753018-2753040 GCCCCAGTGTCCACAGAGCCGGG - Intergenic
1161217594 19:3102223-3102245 GCCTCAGTGGGAACAGAACAAGG + Intronic
1162565697 19:11445053-11445075 GCCACTGTTGGGACAGAGGTGGG - Intronic
1163368165 19:16887852-16887874 GCCCCAGTGTGCTCAGCGCTGGG - Intergenic
1164788761 19:30958736-30958758 GCCAGAGTGAGGACAGTGCTTGG - Intergenic
1165255518 19:34575472-34575494 CCCACAGTGGGCACAGCGTTAGG - Intergenic
1165441930 19:35833392-35833414 TCCACAGTGGGCACATGGCCCGG + Intronic
1166052438 19:40268313-40268335 CCCACTGTGGGCCCAGGGCTCGG + Intronic
1166103882 19:40588229-40588251 GCCACAGAGGGCTCCGAGCAGGG + Intronic
1166370825 19:42299886-42299908 GCCACAGTTGGCACAGTTCTAGG - Intronic
1167248630 19:48389757-48389779 GCCCCAGTAGGCTCAGAGCCCGG + Intronic
1168681535 19:58319437-58319459 GCCACAGTGGCCACACATGTAGG - Intergenic
1202699616 1_KI270712v1_random:154508-154530 GTCACAGTGGGCACAGTCCTGGG + Intergenic
925184876 2:1840303-1840325 GCTGCAGTGGACACTGAGCTTGG - Intronic
926596731 2:14797705-14797727 GCTATAGTGGTCACAGAGTTCGG + Intergenic
926942907 2:18156651-18156673 GCCACAGTGGACACAGTGAATGG - Intronic
927052924 2:19348099-19348121 GCCATAGTGGGCGCAGAAGTGGG + Intergenic
927672925 2:25083968-25083990 GTTACAGTTGTCACAGAGCTAGG - Intronic
928716240 2:34063936-34063958 GCCACAGTAGGCCCAAAGGTTGG - Intergenic
928861458 2:35862141-35862163 GCCATAGTTTGCACAGATCTGGG + Intergenic
929714371 2:44295384-44295406 GCAAAAATGGGCACAGAGCCTGG - Intronic
931115240 2:59159421-59159443 GCCACAGTTGGCATTGAGCAAGG + Intergenic
934170561 2:89537996-89538018 GTCACGGTGGGCACAGTCCTGGG + Intergenic
934280863 2:91612316-91612338 GTCACGGTGGGCACAGTCCTGGG + Intergenic
934675199 2:96244904-96244926 CCCACAGTGGATACAGAGCGTGG + Intergenic
936108749 2:109647913-109647935 GCCTCAGTGGGCACTGAGTGAGG - Intergenic
937868595 2:126771785-126771807 GCCACAGGGAGCACAGAGTAGGG + Intergenic
938163692 2:129008624-129008646 CCCACAGCTGGCACAGAGCAGGG - Intergenic
938378629 2:130824355-130824377 GCCGCAGAGTGCACTGAGCTGGG - Intergenic
938422159 2:131154493-131154515 GTCACAATGGGGACAGAGCAGGG - Intronic
938944514 2:136199591-136199613 GCCAGAGTGGTAGCAGAGCTCGG - Intergenic
942138717 2:172955852-172955874 GTCGCAGTGGCCACAGGGCTGGG - Intronic
942799312 2:179858613-179858635 GACACAGTGGGGACAGAGTCAGG + Intronic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
944082634 2:195805754-195805776 GGCACAGGAGGCACAGTGCTTGG - Intronic
944130030 2:196337731-196337753 GCCTCAGAGGGCAGTGAGCTAGG + Intronic
946023354 2:216656948-216656970 GCCTCTGTGGGCACAAAGCTGGG + Intronic
947855354 2:233320303-233320325 GCCTCTGAGGCCACAGAGCTAGG + Intronic
948262491 2:236614505-236614527 GCCACAGCTGCCAGAGAGCTTGG + Intergenic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
948654919 2:239470683-239470705 CCCCCAGGGAGCACAGAGCTGGG + Intergenic
948709484 2:239817021-239817043 GCATCAGTGGGCACAGAGGCAGG - Intergenic
948741299 2:240048326-240048348 GCCAGAGTGGGGACGGGGCTGGG - Intergenic
948901072 2:240957172-240957194 GCCAGGGAGGGCAGAGAGCTGGG - Intronic
1169088498 20:2841654-2841676 GCCTCACTGGGCCCAGTGCTAGG + Intronic
1169221379 20:3825032-3825054 GCCTAAGTGGGCACAAAGCCAGG - Exonic
1169732439 20:8801154-8801176 GCCACACTGGGCTCATTGCTAGG + Intronic
1171385615 20:24767696-24767718 GACACAGTCCACACAGAGCTTGG - Intergenic
1171973112 20:31576967-31576989 ATCCCAGGGGGCACAGAGCTGGG - Intronic
1172116651 20:32577028-32577050 CCCACAGTGAACACACAGCTGGG - Intronic
1172704490 20:36872995-36873017 ACCAGAGTGGGCACAGGGCCAGG + Intergenic
1173410740 20:42807476-42807498 GCCACAGAGAGCACAGGGCTCGG - Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1174645692 20:52083729-52083751 GGCCCAGTGGGCCCTGAGCTTGG - Intronic
1175367564 20:58466595-58466617 GCCACAGCGGGCACCTAGCACGG - Intronic
1175819336 20:61900172-61900194 GCCAGAGTGGGCACGCAGCCAGG - Intronic
1177192036 21:17862756-17862778 TACACAGTGGGCACAGAGAGAGG + Intergenic
1177464508 21:21458190-21458212 GCCCCAGTGGGGCCACAGCTGGG - Intronic
1177745778 21:25211492-25211514 GCCAAAGTGGAGAAAGAGCTGGG - Intergenic
1178102576 21:29285823-29285845 CAAACATTGGGCACAGAGCTAGG - Intronic
1178534117 21:33398468-33398490 GCTTGACTGGGCACAGAGCTGGG + Intergenic
1180021024 21:45127126-45127148 TCCCCAGTGGGCAGAGAGCAAGG - Intronic
1180763039 22:18223469-18223491 GCCACAGCGGGCACCGAGGCAGG + Intergenic
1180772604 22:18401078-18401100 GCCACAGCGGGCACCGAGGCAGG - Intergenic
1180803984 22:18650694-18650716 GCCACAGCGGGCACCGAGGCAGG - Intergenic
1180806779 22:18718755-18718777 GCCACAGCGGGCACCGAGGCAGG + Intergenic
1180888532 22:19267591-19267613 GCAAGAATGGGCACAGATCTGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181217735 22:21344565-21344587 GCCACAGCGGGCACCGAGGCAGG + Intergenic
1182051766 22:27317732-27317754 GCCACTGTGGGCCCAGGTCTTGG - Intergenic
1182077404 22:27504468-27504490 GCCACAGTTGGCAGGCAGCTTGG - Intergenic
1182357463 22:29728764-29728786 TCCACAGTGTGCACAGCCCTGGG - Intronic
1182512634 22:30829925-30829947 GCCAAAGTGGGAGCAGGGCTTGG + Intronic
1182552055 22:31105886-31105908 GGCTCAGGGGGAACAGAGCTAGG + Intronic
1182624810 22:31638085-31638107 GCCTGAGTGGCCACAGAGCAGGG - Intronic
1183105042 22:35609559-35609581 GCCACAGTGGATTCAGAGCCTGG + Intronic
1183110087 22:35642461-35642483 GCCACAGTGGGAGCAGAACTAGG + Intergenic
1183519264 22:38287096-38287118 GCAACAGTGGGCAGGGAGATTGG - Intergenic
1183592287 22:38786783-38786805 GCAACAGTGGGCACAGACAAGGG + Intronic
1184176646 22:42792906-42792928 GCCCCAGTGGGCCCAGCTCTGGG + Intergenic
1184380710 22:44143458-44143480 GCCACAGTCTGCACGCAGCTGGG + Intronic
1184900443 22:47443533-47443555 GGGACAGTGGTCACAGAGCTGGG - Intergenic
1185318958 22:50191431-50191453 GCCACAGCAGGCACAGACCTCGG - Intronic
1203234442 22_KI270731v1_random:142066-142088 GCCACAGCGGGCACCGAGGCAGG - Intergenic
950448051 3:13049362-13049384 GCCAGAGTGAGATCAGAGCTGGG - Intronic
950609717 3:14118249-14118271 GCCACTGTGGGCGCAGAGGCCGG + Intronic
950903453 3:16516803-16516825 GCCACAGTGAGCTCACAGTTTGG + Intergenic
951524973 3:23644766-23644788 GCCTCTGTGGGTACAGGGCTGGG + Intergenic
952030503 3:29136548-29136570 GGGACAGTGGGGAAAGAGCTGGG - Intergenic
953814627 3:46144416-46144438 GCAGTAGTGGGCACAGAGGTGGG - Intergenic
957702193 3:83728277-83728299 GCAACAGTGGGAAAAGAACTTGG + Intergenic
959101916 3:102020386-102020408 GTCTCAGTGGGCAGTGAGCTTGG + Intergenic
961552855 3:127679041-127679063 GCTACAGGGGCCAGAGAGCTGGG - Intronic
962888864 3:139653643-139653665 GCCCCAGCTGGGACAGAGCTAGG - Intronic
962971744 3:140407816-140407838 GTCACAGTGGTGATAGAGCTAGG + Intronic
963313638 3:143734797-143734819 GTCACAGAGGTGACAGAGCTGGG + Intronic
965147726 3:164927980-164928002 GCCACAGCTGGCACAGAGGTGGG - Intergenic
966739753 3:183221626-183221648 GCCTCACTGGGCCCAGAGGTTGG + Intronic
967227442 3:187305541-187305563 GGCACAGTGAGCGCAGAGCCTGG + Intergenic
968504038 4:963847-963869 GACACAGCGGGCTCAGGGCTGGG + Intronic
968605470 4:1533120-1533142 GCCACAGTGGCCAAGGGGCTTGG + Intergenic
968662338 4:1803963-1803985 CCCACACTGGGCACAGGGCCAGG - Intronic
968962340 4:3751975-3751997 GCCACTCTGGACACAGAGGTGGG + Intergenic
969447940 4:7256020-7256042 GCCCCAGTGGGGCCAGACCTAGG - Intronic
976931621 4:90573184-90573206 GCTACAGCAGGCACAGTGCTGGG + Intronic
979383110 4:120031820-120031842 GGCACTGTGGGCACAGCACTCGG + Intergenic
981209546 4:142086463-142086485 GCCACTTTGGGCACTGAGGTGGG - Intronic
981537595 4:145815980-145816002 GCCAAAGTGGCCACAGCCCTGGG + Intronic
985587405 5:747913-747935 CTCACAGTGGGCACAGCGGTAGG - Intronic
985601957 5:840005-840027 CTCACAGTGGGCACAGCGGTAGG - Intronic
985877776 5:2613292-2613314 GCAACAGTGGGCACAGAGGCAGG - Intergenic
986270690 5:6228213-6228235 ACCTCTCTGGGCACAGAGCTGGG - Intergenic
986685784 5:10274190-10274212 GACACAGGGGGCACACAGCTGGG + Intergenic
988697580 5:33638710-33638732 ACCACAGAGGACACAGAGCTTGG - Intronic
989503555 5:42198506-42198528 GCCAAAGTGAGCAGACAGCTTGG - Intergenic
989749939 5:44881298-44881320 GCGTCACTGAGCACAGAGCTGGG - Intergenic
990107853 5:52286709-52286731 ACAACACTGGGCATAGAGCTGGG + Intergenic
994003042 5:94804047-94804069 GCAAGAGTGAGCCCAGAGCTAGG + Intronic
997564453 5:134876208-134876230 GCCACACAGGGCACAGAGCACGG - Intronic
998430160 5:142063715-142063737 GCCCCAAAGGGCACACAGCTTGG - Intergenic
998463199 5:142324391-142324413 GGCACCGTGGGCACCGAGCTGGG + Intronic
998685926 5:144524885-144524907 TCCACAGTGGGCATAAACCTTGG + Intergenic
999316843 5:150589834-150589856 ACTACAGAGAGCACAGAGCTGGG - Intergenic
999751260 5:154629669-154629691 GCCACAGTGTTCACAGGGCCAGG + Intergenic
999758138 5:154680447-154680469 GGCACAGAAGGCACAGGGCTTGG - Intergenic
1001293794 5:170484891-170484913 CACCCAGTGGGCTCAGAGCTGGG + Intronic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002776652 6:333694-333716 GGCAAAGTGGGCGCTGAGCTTGG - Intronic
1002857355 6:1050149-1050171 GAGACAGTGGGCACAGAGAGGGG + Intergenic
1003020986 6:2509357-2509379 GATTTAGTGGGCACAGAGCTGGG - Intergenic
1003114705 6:3276238-3276260 TCCACCATGGGCACAGGGCTTGG + Intronic
1003195524 6:3910704-3910726 TTCACAGTGGGGCCAGAGCTGGG - Intergenic
1003620670 6:7696643-7696665 GCCAGAGTGGGTACAGGGCCAGG - Intergenic
1004657412 6:17677137-17677159 GCCACAGGGGAGACAGAGCTTGG + Intronic
1006373515 6:33659401-33659423 GCCACTGAGGGCCCAGAGCAGGG - Intronic
1006720677 6:36148041-36148063 CCCACAGTAGGAACACAGCTGGG + Intergenic
1006782761 6:36643336-36643358 CCCACGGGGAGCACAGAGCTGGG + Intergenic
1006782767 6:36643359-36643381 TCCACGGGGAGCACAGAGCTGGG + Intergenic
1006782773 6:36643382-36643404 TCCACGGGGAGCACAGAGCTGGG + Intergenic
1007611849 6:43154834-43154856 CCACCAGTGGGCACAGAGGTTGG - Intronic
1009049183 6:58258280-58258302 GCCCCAGAGAGCACAGGGCTGGG - Intergenic
1009899626 6:69796310-69796332 CACACAATGGGCACAGAGGTTGG + Intronic
1013564246 6:111341622-111341644 GCCACAGTCTACACAGAGCAAGG + Intronic
1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG + Intronic
1018702867 6:166441235-166441257 GCCACAGTGGAAACAGAGAAAGG - Intronic
1019420464 7:948309-948331 GCCTCGGTGGGTACAGAGGTGGG - Intronic
1019506206 7:1392782-1392804 GCCAGAGTGGGCTCACAGCTGGG - Intergenic
1020016292 7:4834032-4834054 GCCACAGTGTCCACAGGGCCGGG + Intronic
1023042059 7:36180760-36180782 GTCCCAGCGGGCACAGAGCAGGG - Intronic
1023605392 7:41926662-41926684 GCCACAGTGGACAGAGTGTTAGG + Intergenic
1023634446 7:42195565-42195587 GCACCATTGGGAACAGAGCTGGG - Intronic
1024648503 7:51387297-51387319 GCCGCAGTGGGGCGAGAGCTTGG - Intergenic
1025129308 7:56367449-56367471 GCCGCAGTGGGGGGAGAGCTGGG - Intergenic
1025176081 7:56803155-56803177 GCCACAGTGAGGCCCGAGCTGGG + Intergenic
1025176416 7:56804513-56804535 GCCACCGTGGGGCGAGAGCTGGG - Intergenic
1025695373 7:63771873-63771895 GCCACCGTGGGGTGAGAGCTGGG + Intergenic
1025695713 7:63773267-63773289 GCCACAGTGAGGCCCGAGCTGGG - Intergenic
1026586639 7:71661068-71661090 GAAACAGTGAGGACAGAGCTGGG - Intronic
1026766081 7:73160714-73160736 GCCACAGAGGGCCCTCAGCTAGG - Intergenic
1027042556 7:74970410-74970432 GCCACAGAGGGCCCTCAGCTAGG - Intronic
1027081087 7:75231947-75231969 GCCACAGAGGGCCCTCAGCTAGG + Intergenic
1028167675 7:87556979-87557001 GCCATGGTGGGAACAGAGATGGG - Intronic
1030091607 7:105863277-105863299 GCCACAGAGGCCCCAAAGCTGGG + Intronic
1030654520 7:112151448-112151470 ACCACAGTTGTCACACAGCTAGG + Intronic
1034343306 7:150371408-150371430 TCGACAGTGGGCACAGCGATGGG - Exonic
1034867056 7:154650714-154650736 GCCACTGTGGCCACAGCACTCGG + Intronic
1035307440 7:157942300-157942322 CCCACCGTGGGCTCTGAGCTGGG - Intronic
1036737378 8:11330618-11330640 GCCCCAGAGAGCACAGGGCTGGG - Intergenic
1036762319 8:11517929-11517951 CCCTCAGTGGGCACAGGGCTGGG - Intronic
1037779916 8:21860900-21860922 GACACAGTGCGCAGAGAGCATGG + Intergenic
1038322302 8:26538723-26538745 TGCACAGTAGCCACAGAGCTAGG - Intronic
1038483863 8:27919969-27919991 GCCACAGTGGGCTTTGAGCAGGG + Intronic
1038871252 8:31496366-31496388 GTCTCAGTGGGCACAGAGTGAGG + Intergenic
1040071249 8:43190515-43190537 GCCTGAGTGGGCACAGAGCTTGG + Intronic
1040551502 8:48440970-48440992 GCCACAGTCAGAGCAGAGCTGGG - Intergenic
1040701463 8:50071092-50071114 GCCAAGGTGGTCACAGAGATTGG + Intronic
1041963444 8:63647088-63647110 CTCACAGTGATCACAGAGCTGGG - Intergenic
1047641808 8:126828619-126828641 TCCAAAGTGGACACTGAGCTAGG + Intergenic
1048301380 8:133253758-133253780 GCTACAGTGAGCAGTGAGCTGGG - Intronic
1049355850 8:142187656-142187678 GCCACCTGGGGAACAGAGCTGGG + Intergenic
1049433973 8:142577759-142577781 GCCACAGAGGGTGCAGAGCGTGG + Intergenic
1049583985 8:143424593-143424615 GCCACAGTGGGCTCTGACATGGG - Intronic
1049798734 8:144508164-144508186 GCCCCAGAGGGCACAGCTCTGGG + Intergenic
1052990681 9:34517859-34517881 GCCCCAGTGGTCCCTGAGCTGGG + Intronic
1053606716 9:39667266-39667288 GGCAAGGTGGGCACAGAGATAGG + Intergenic
1053864634 9:42423893-42423915 GGCAAGGTGGGCACAGAGATAGG + Intergenic
1054560941 9:66709672-66709694 GGCAAGGTGGGCACAGAGATAGG - Intergenic
1054870218 9:70042460-70042482 ACCACCATGGGCACAGAGCATGG + Intergenic
1055144159 9:72912675-72912697 GCCCCAGTGGGACCAGAACTGGG - Intronic
1055190733 9:73520477-73520499 GCCACACTTTGCACTGAGCTGGG + Intergenic
1056190580 9:84180560-84180582 GCCACAGTGGGACCAGATTTAGG + Intergenic
1057051491 9:91927518-91927540 GCCACAGAGGGCACAGAGATAGG - Intronic
1057184549 9:93049641-93049663 AACACAGTGGGGACAGGGCTGGG + Intergenic
1057282177 9:93720818-93720840 GGCTCTGTGAGCACAGAGCTGGG + Intergenic
1057453048 9:95182717-95182739 GCCGCTGTGGGAACAGAGCAAGG + Intronic
1057798287 9:98173497-98173519 GCCGCAGTGGCCACCGAGTTGGG - Intronic
1057822772 9:98345143-98345165 GTCACAGTGGGAACAGAGAAGGG - Intronic
1059467258 9:114476842-114476864 GACACTGTGAGCACAGGGCTGGG + Intronic
1059977900 9:119737331-119737353 GGCAAAGTGAGAACAGAGCTTGG - Intergenic
1060416204 9:123432491-123432513 CCTACAGTGGGCACAGAGGCCGG + Intronic
1061653527 9:132069975-132069997 GCCACACTGGGCACCGGCCTAGG + Intronic
1061731209 9:132615509-132615531 CCCTCAGTGGGGTCAGAGCTAGG - Intronic
1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG + Intronic
1061929914 9:133827168-133827190 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061929934 9:133827264-133827286 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061929958 9:133827360-133827382 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061929976 9:133827456-133827478 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930017 9:133827648-133827670 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930038 9:133827744-133827766 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930049 9:133827792-133827814 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930060 9:133827840-133827862 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930084 9:133827936-133827958 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930095 9:133827984-133828006 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930106 9:133828032-133828054 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930128 9:133828128-133828150 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930148 9:133828224-133828246 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930171 9:133828320-133828342 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930182 9:133828368-133828390 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930195 9:133828416-133828438 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1062232106 9:135487460-135487482 GCCACAGCGGGCACCGAGGCAGG + Exonic
1062550112 9:137082285-137082307 CCCACACTGGGCTCAGACCTGGG - Intronic
1203441903 Un_GL000219v1:16480-16502 GTCAGAGAGGGGACAGAGCTGGG - Intergenic
1203512711 Un_KI270741v1:135389-135411 GTCAGAGAGGGGACAGAGCTGGG - Intergenic
1187085800 X:16042440-16042462 GACACAGTGGCCACAAAGATTGG + Intergenic
1190886962 X:54538941-54538963 GCCACACTGGGAACCTAGCTAGG - Intronic
1191688785 X:63919410-63919432 CCCACAGTGGGCAGAGCTCTTGG + Intergenic
1192165215 X:68823711-68823733 TCCAGAGAGGGCTCAGAGCTAGG + Intergenic
1192360521 X:70435854-70435876 AACACAGGGGGCACAGAGCTGGG + Intergenic
1200046380 X:153404838-153404860 GCCACAGAGGACACCGTGCTGGG - Intergenic
1200952805 Y:8917779-8917801 GCCCCAGAGAGCACAGGGCTGGG + Intergenic
1201011779 Y:9554287-9554309 GCTACAGTGGGCAGAGATCATGG - Intergenic
1201345757 Y:12982857-12982879 GCTGCAGCAGGCACAGAGCTGGG - Intergenic
1202380896 Y:24276126-24276148 GCCACAGTGGGGTGAGAGCTGGG + Intergenic
1202489888 Y:25393999-25394021 GCCACAGTGGGGTGAGAGCTGGG - Intergenic