ID: 1002201342

View in Genome Browser
Species Human (GRCh38)
Location 5:177530420-177530442
Sequence CAGGAGAGGGAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2258
Summary {0: 1, 1: 0, 2: 9, 3: 409, 4: 1839}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002201342_1002201347 -8 Left 1002201342 5:177530420-177530442 CCTGCCTCCATCTCCCTCTCCTG 0: 1
1: 0
2: 9
3: 409
4: 1839
Right 1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002201342 Original CRISPR CAGGAGAGGGAGATGGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr