ID: 1002201347

View in Genome Browser
Species Human (GRCh38)
Location 5:177530435-177530457
Sequence CTCTCCTGCCATCAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002201342_1002201347 -8 Left 1002201342 5:177530420-177530442 CCTGCCTCCATCTCCCTCTCCTG 0: 1
1: 0
2: 9
3: 409
4: 1839
Right 1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1002201339_1002201347 16 Left 1002201339 5:177530396-177530418 CCAAGCAAACACCTGGGAGACAT 0: 1
1: 0
2: 4
3: 18
4: 232
Right 1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1002201341_1002201347 -7 Left 1002201341 5:177530419-177530441 CCCTGCCTCCATCTCCCTCTCCT 0: 1
1: 1
2: 28
3: 350
4: 2980
Right 1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1002201340_1002201347 5 Left 1002201340 5:177530407-177530429 CCTGGGAGACATCCCTGCCTCCA 0: 1
1: 0
2: 2
3: 42
4: 407
Right 1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002201347 Original CRISPR CTCTCCTGCCATCAGATCAA AGG Intronic
901680826 1:10911789-10911811 ATCTTCTGCCATCAAATCACTGG + Intergenic
902805898 1:18861205-18861227 CACTCCTGCCCCCAGTTCAAGGG + Intronic
903352125 1:22723582-22723604 CTCTCCTGGCCTCAGGCCAAGGG - Intronic
904360810 1:29970642-29970664 CTCTCCATCCATTAGATCATGGG - Intergenic
906716667 1:47974864-47974886 TTCTCCTCACATCATATCAAAGG - Intronic
907505655 1:54916296-54916318 CTCTCTCCACATCAGATCAAAGG + Intergenic
909722022 1:78784046-78784068 CTCTGCTCACATCATATCAAGGG - Intergenic
909799671 1:79790396-79790418 CTCTCCTGCTCTCTGATCTATGG + Intergenic
910454834 1:87386417-87386439 CTGTCCTGTTATCAGATCAAGGG + Intergenic
910643471 1:89489283-89489305 CTCTCCTGTCTTCAGATGGAAGG - Intergenic
911520924 1:98929611-98929633 CTCTGCTGCCCTCAGCACAAAGG + Intronic
914215593 1:145625093-145625115 CTCTCCTGCAGTAAGATCAGAGG + Intronic
914467541 1:147945477-147945499 CTCTCCTGCAGTAAGATCAGAGG + Intronic
916256951 1:162798553-162798575 TTCTCATGACATCATATCAAGGG + Intronic
916771250 1:167910797-167910819 CTCTCCTGCCCCCAGTTCACTGG + Intronic
917222707 1:172748757-172748779 CCCTCCAGCCCTCAGATCATGGG + Intergenic
921051837 1:211516502-211516524 CCCACCTGCCAGCAGGTCAAAGG + Intergenic
922200367 1:223395286-223395308 CTCTAGTACCATCTGATCAAGGG - Exonic
924198619 1:241637815-241637837 CTCTTGTGCCATCAGACCAATGG + Intronic
1062861070 10:809943-809965 CCCTCCTGTCATCACATCACCGG - Exonic
1064410509 10:15099970-15099992 CTCTGCTGCCTGTAGATCAAGGG - Intronic
1066723413 10:38364248-38364270 TTCTCATGACATCACATCAAGGG + Intergenic
1072322659 10:94265908-94265930 CTCACGGGCCATCAGCTCAAAGG + Exonic
1072982790 10:100113732-100113754 CTCTCCTGTCGTCTGACCAATGG + Intergenic
1074985924 10:118659294-118659316 TTCTCCTGCCAACAGATCTTCGG + Intergenic
1075220862 10:120583295-120583317 CCCTCTTGCCATGAGGTCAAAGG - Intronic
1076162205 10:128253811-128253833 CTCTACAGCCACCAGATCAATGG - Intergenic
1077138208 11:1012125-1012147 CCCTCCCGCCATCAGAGGAAAGG + Exonic
1077647673 11:3940250-3940272 CTCTCCTCCCCTCACACCAACGG - Intronic
1077921295 11:6643681-6643703 CTCCCATGCCTTCAGTTCAAAGG + Intronic
1078186845 11:9059048-9059070 CTCTGCTGTCATCACATCGATGG + Intronic
1078455056 11:11468564-11468586 CTCACCTGCCCTTAGAGCAAGGG - Intronic
1078569557 11:12445465-12445487 CTCAGCTCCCATTAGATCAATGG - Intronic
1083001005 11:59290640-59290662 CAATCCTGGCACCAGATCAATGG - Intergenic
1083313307 11:61797496-61797518 CTCTCACTCCATGAGATCAAAGG + Intronic
1084387426 11:68852861-68852883 CTCTCCTGGCACCTGATCCATGG - Intergenic
1084440868 11:69172310-69172332 CTCTCCTCCAATCAGAACCATGG - Intergenic
1084577034 11:69995695-69995717 TTCTCATGGCATCATATCAAGGG + Intergenic
1084716868 11:70879777-70879799 CTCTCCTGGCACCAGCTGAATGG + Intronic
1085645968 11:78223097-78223119 CTCTCCTGGCATTGGATCAGTGG - Intronic
1085693899 11:78687823-78687845 CTATCCTGTTATCAGAACAAAGG - Intronic
1089177274 11:116557938-116557960 CTCACCTGCCATTAGAGGAAAGG + Intergenic
1096050319 12:48601759-48601781 CTCTGCTAACATCATATCAAGGG - Intergenic
1102541650 12:113624015-113624037 TTCTCATGACATCATATCAAGGG + Intergenic
1105567627 13:21565919-21565941 CTCTCCAACCACCAGATGAATGG - Intronic
1108774136 13:53743418-53743440 CTCTCCTCTCATCAGAACAAAGG - Intergenic
1111456842 13:88495678-88495700 CTCTATTGACTTCAGATCAATGG + Intergenic
1112649336 13:101375915-101375937 CTCTCCTGCCATCACATCCCTGG + Intronic
1112662494 13:101527255-101527277 CTCTCCTTCCATCAGCCCATAGG + Intronic
1113087166 13:106580500-106580522 AGCTCCTGCCACCAGATGAAAGG + Intergenic
1116672720 14:47863861-47863883 CTCTTCTGCCCTCAGATACATGG - Intergenic
1116889564 14:50254960-50254982 CTCTACCGCCATTAGCTCAAGGG - Intronic
1119644298 14:76337417-76337439 AACTCCTGCCTCCAGATCAAGGG + Intronic
1120441449 14:84545997-84546019 TTCTCCTACCATGAGAACAAAGG - Intergenic
1121591977 14:95121985-95122007 CTTTCCTTCCATCAGTTTAATGG - Intronic
1121649984 14:95550821-95550843 CTCTCCTGCCTTTTGATCCATGG + Intergenic
1124397739 15:29319435-29319457 CACTGCTGCCATCAGTCCAATGG + Intronic
1125491183 15:40149712-40149734 CTCTCTTCCCATCAGAACTAGGG + Intergenic
1125925546 15:43560019-43560041 CCCTCCTGCCACTAGATCATGGG - Intronic
1125938690 15:43659570-43659592 CCCTCCTGCCACTAGATCATGGG - Intronic
1126469264 15:48990010-48990032 CTCTTCTGCCAGCAAATCCAAGG - Exonic
1127018833 15:54722052-54722074 CTCTATTGCCATGAGTTCAATGG + Intergenic
1128198598 15:65784052-65784074 CTCTCATTGCATCATATCAAGGG - Intronic
1129669819 15:77601234-77601256 CACACCTGCCATAAGATCATGGG - Intergenic
1131391614 15:92053774-92053796 TTCTCATCCCATCATATCAAGGG + Intronic
1132001529 15:98185400-98185422 TTCTCATGACATCATATCAAGGG + Intergenic
1139552403 16:67681853-67681875 CTCTCCTGCCAGGAAGTCAAGGG + Intronic
1139575633 16:67840370-67840392 CTCTCCTGATAGCAGATCACAGG - Intronic
1140944698 16:79757085-79757107 CTCTCCTACCAAGAGATCACAGG - Intergenic
1142514859 17:421029-421051 CTTTCCAGCCCTCAGATTAAGGG - Intronic
1142553294 17:753778-753800 GTCTCCTGCCCTCAGATCTTGGG - Intronic
1143144851 17:4768251-4768273 CTCTCTGTCCATCAGATCAATGG + Intergenic
1148630984 17:49109011-49109033 GTCTCCAGCTATCTGATCAATGG + Intergenic
1148653752 17:49268113-49268135 CTCTCCTGCCATCCCACCACCGG + Intergenic
1149042207 17:52203433-52203455 TTCTCCAGCCATGAGATTAAGGG - Intergenic
1151360337 17:73584819-73584841 CTCTCCTGCCACCACATCCCTGG + Intronic
1156587184 18:38444381-38444403 TTCTCATGCCATCATATCAGTGG + Intergenic
1156897540 18:42263408-42263430 CACTCCTGCTATCAGATCACAGG + Intergenic
1160805269 19:989810-989832 GTCTCCTGCCTTCAGTTCACAGG + Exonic
1162718098 19:12646638-12646660 CTTTCCTGGCCTCAGTTCAATGG - Exonic
1163190074 19:15670899-15670921 TTCTCCTCCCAACAGATCCAGGG - Intergenic
1164905021 19:31960225-31960247 CTCTCCTGCTTTGAGCTCAATGG - Intergenic
1166215561 19:41332274-41332296 CTCTCCTGCCTGCAGCTCCACGG - Exonic
1166303036 19:41922784-41922806 CTCTCATCCCATCTGATCGATGG - Intronic
1168413918 19:56157030-56157052 CTGTCCTGGCCTCAGCTCAAGGG - Intronic
926814046 2:16782802-16782824 CTCTGCTCACATGAGATCAAAGG - Intergenic
926976767 2:18523530-18523552 TCCTCCTGCCTGCAGATCAAGGG + Intergenic
932232720 2:70095785-70095807 CCCTCCTGCCCTCAAAGCAAGGG + Intergenic
935172010 2:100617564-100617586 GGGTCCAGCCATCAGATCAAAGG + Intergenic
936461114 2:112714344-112714366 CTCTCCTTCCATCAAAACAATGG - Intergenic
939452435 2:142391370-142391392 CTCTCCTACAAGCACATCAAAGG - Intergenic
941274946 2:163479551-163479573 CTCTGATGGCATCAAATCAAGGG + Intergenic
941604854 2:167584445-167584467 CACTTCTGACATCAGATGAATGG + Intergenic
943447805 2:188010692-188010714 TTCTCCTGCCATCAATTCAGAGG + Intergenic
944684785 2:202108675-202108697 CTCTCAGCCCATCATATCAAGGG + Intronic
946612749 2:221477135-221477157 CTGTTTTGCCATCAGATGAACGG - Intronic
948829076 2:240588837-240588859 CTCTCCTGCCCTCAGAGCCTGGG - Intronic
1169551648 20:6707480-6707502 CTCCCCTTCCATCACATGAATGG + Intergenic
1169629847 20:7618538-7618560 CTGTCATTACATCAGATCAAGGG - Intergenic
1173309514 20:41884631-41884653 ATCCCGTGCCATGAGATCAACGG + Intergenic
1173842466 20:46166833-46166855 CTCTCCTGACCTCAGAACCAAGG + Intergenic
1174766946 20:53263683-53263705 CTGACCTGCCACCAGATCCAGGG - Intronic
1175418960 20:58819500-58819522 CTCTCCCCCCATCAGAAAAAGGG - Intergenic
1175862031 20:62155683-62155705 ATCTCCTGCCAGCAGATCCTGGG + Intronic
1181349576 22:22245331-22245353 CTCTGCTGTCTTCAGTTCAAGGG - Exonic
1181584756 22:23847043-23847065 CTCTCCTTCCACCAGACCCATGG - Intergenic
1181592974 22:23896086-23896108 CTCTCCTTCCAGAAGAGCAATGG + Exonic
1183027103 22:35073494-35073516 CTCACCTGCTGTCAGATCAGTGG - Intronic
1183481541 22:38068181-38068203 CTCTCCTGCCATCAGCTCCCAGG + Intronic
1183521647 22:38299128-38299150 CTCTGCTGCTTTCAGAGCAAGGG + Intronic
953056244 3:39389595-39389617 CCCTCCAGCCCTCAGATCATGGG + Exonic
953793428 3:45965663-45965685 CTCTCCTGACAGCAGATACAGGG - Intronic
958744724 3:98118904-98118926 CTCTCCTCCCTTCATCTCAAAGG + Intergenic
958847143 3:99278530-99278552 CTCTCCTTCCCTCAAATAAAAGG - Intergenic
959574312 3:107917840-107917862 TTCTCCTCCCATCATATCAAGGG - Intergenic
959692760 3:109217559-109217581 CTGTCCAGCCATCAGAGAAAGGG + Intergenic
960614312 3:119582828-119582850 CTCTGCCTCCATCAGATCAGTGG + Intronic
964626590 3:158765690-158765712 ATCTCCTGCCAGCTGATCAAGGG - Intronic
966677628 3:182606402-182606424 TTCTCATGACATCATATCAAGGG - Intergenic
967508368 3:190280201-190280223 CTCTCAAGGCATCAGAACAAAGG + Intergenic
972768361 4:42172479-42172501 CTCTCTTCCCCTCAGATCCATGG + Intergenic
973213725 4:47645575-47645597 CTCTCCTAACAGAAGATCAAAGG + Intronic
975050112 4:69852513-69852535 CTCTCCTACAATCAAACCAATGG + Intronic
976049791 4:80998131-80998153 CTCTCCTGCCACCATGTGAAAGG + Intergenic
981921996 4:150096000-150096022 CTCTACTGCCCTTAGAACAAAGG - Intronic
984565267 4:181322484-181322506 CTCTCATCACATCATATCAAGGG + Intergenic
986130363 5:4924345-4924367 CACTCCTGCCATCCCATCCATGG - Intergenic
986332068 5:6724768-6724790 CTCTGCTGCCATCAGGTGAGTGG + Intronic
988141188 5:27242979-27243001 CTCTTATCACATCAGATCAAGGG - Intergenic
988144715 5:27291362-27291384 CTCCTCTGCCGTCAGATCAGCGG + Intergenic
988498972 5:31768264-31768286 CACTCCAGCCATCAGCCCAAGGG + Intronic
991077806 5:62561236-62561258 CTCTTCTGCCATCTGATAATAGG + Exonic
995010745 5:107255075-107255097 CTCTGGGGCCATCTGATCAAAGG - Intergenic
999610849 5:153367949-153367971 CTCTCATGTCATCTGGTCAAAGG + Intergenic
1001164175 5:169348452-169348474 CACTCCAGCCCTCAAATCAATGG + Intergenic
1002201347 5:177530435-177530457 CTCTCCTGCCATCAGATCAAAGG + Intronic
1002307754 5:178293745-178293767 ATCTCCAGCCTTCAGATCCATGG - Intronic
1002382396 5:178840079-178840101 CTCTCACGCCATGAGATCCACGG - Intergenic
1002382801 5:178842244-178842266 CTCTCAGGCCATGAGATCCATGG + Intergenic
1002648180 5:180672596-180672618 CTCTCACGCCATGAGATCCACGG + Intergenic
1002710799 5:181193878-181193900 CGCTCCTGCACTCAGATCTAGGG + Intergenic
1003548118 6:7078298-7078320 CTCTCTTGCAATCAGAGGAAAGG - Intergenic
1003777772 6:9388329-9388351 CTTTCCTGCCTTCAGAACATTGG - Intergenic
1005881384 6:30064200-30064222 CTTTCTTGCCATCTCATCAAAGG + Intronic
1006503370 6:34472598-34472620 CTCACATGCCATCAGATTAAGGG - Intronic
1006775934 6:36592611-36592633 CTTTCCTTCTATCAAATCAAAGG - Intergenic
1007939816 6:45769856-45769878 TTCTCCTGCCATCAGAACTTTGG - Intergenic
1010490268 6:76467457-76467479 TTCTCCTGCCATCAGCCCCAAGG - Intergenic
1011004124 6:82624764-82624786 GTCACCTGCCTTCAGATCCAGGG - Intergenic
1011541219 6:88432259-88432281 CACTTCTGTCAGCAGATCAAAGG - Intergenic
1013541566 6:111115842-111115864 CCCTCCTGTCACCAGATGAAAGG + Intronic
1018452214 6:163919557-163919579 CTATCCTGGCATCAGAGCAGGGG - Intergenic
1019725250 7:2598560-2598582 CTCTTCTCCCATCAGAGCAGGGG - Exonic
1021623159 7:22567252-22567274 CTCTACCTCCATAAGATCAAGGG + Intronic
1022272486 7:28822865-28822887 CTCTCCTGCGGCCACATCAACGG + Exonic
1022381225 7:29861791-29861813 CTCACATGCCATCATATCTAGGG + Intronic
1022820516 7:33955289-33955311 CTTTCATGCCATGAGATCAGAGG - Intronic
1024422858 7:49189814-49189836 GTCTCCCACCATCAGATAAATGG - Intergenic
1024520188 7:50298881-50298903 CCCACCTCCCATCAGATCAATGG - Intergenic
1028925209 7:96350140-96350162 CTCTCCTGCCATCACTTACAAGG + Intergenic
1031579558 7:123454817-123454839 TTCTCCTCACATCATATCAAGGG + Intronic
1035131120 7:156654609-156654631 CTCCACTGTCATCAGATGAATGG + Exonic
1036833480 8:12039741-12039763 CTCACCTGCCTTCAGATCTTAGG + Intergenic
1036855326 8:12286306-12286328 CTCACCTGCCTTCAGATCTTAGG + Intergenic
1037683091 8:21115056-21115078 CTCTCCTTCAATGAGAACAAAGG - Intergenic
1043307681 8:78817726-78817748 GTCTCCTGACATCAGCTCAGTGG + Intergenic
1043329034 8:79090401-79090423 TTCTCATTCCATCATATCAAGGG - Intergenic
1048237141 8:132701823-132701845 CTCTGCTTCCACCAGAGCAATGG + Intronic
1048559587 8:135519330-135519352 CTCCCCTCCCCACAGATCAAGGG + Intronic
1048710009 8:137199319-137199341 CTCTACTGCCATGAGTTCCAGGG - Intergenic
1050786840 9:9414095-9414117 CTCTCCTGACATCTTCTCAAAGG + Intronic
1051629189 9:19127150-19127172 CTTTCCTGCCAACAGATTTAGGG - Intronic
1056223665 9:84473917-84473939 CTCTCCTGGCCTCTGACCAATGG + Intergenic
1056364090 9:85885594-85885616 CTCTCCTCACATCATGTCAATGG + Intergenic
1058948028 9:109876979-109877001 GCCTCCTGCCATCACATGAAGGG - Intronic
1060408839 9:123386738-123386760 CTTTCCTGCCAGCAGGTCACTGG - Intronic
1189496929 X:41517049-41517071 CTCTGCAGCGATCAGATCAAAGG + Intronic
1190496307 X:51031314-51031336 TTCTCCTGTTATCAGATCACAGG - Intergenic
1190509701 X:51162775-51162797 CTCTCCTGTTATCAGATCACAGG + Intergenic
1190985075 X:55492477-55492499 CTCTCCTGCCCACAGACCCATGG + Intergenic
1191084953 X:56556061-56556083 CTCTACTTTCATTAGATCAACGG - Intergenic
1192226945 X:69235708-69235730 TTCTCATCCCATCATATCAAGGG + Intergenic
1199276952 X:145955778-145955800 CTATTGTGCCATCAGATCATAGG - Intergenic
1201434286 Y:13939923-13939945 CTGTCCTGACAGCAGATCACAGG - Intergenic
1201888562 Y:18916001-18916023 CACTCCTGCCAGCAGAGTAAAGG - Intergenic