ID: 1002201357

View in Genome Browser
Species Human (GRCh38)
Location 5:177530504-177530526
Sequence AGGGAGAGATGATTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002201357_1002201365 14 Left 1002201357 5:177530504-177530526 CCCACAATCAATCATCTCTCCCT 0: 1
1: 0
2: 1
3: 27
4: 376
Right 1002201365 5:177530541-177530563 TGCCTGAGGCATCGAACTCGAGG 0: 1
1: 0
2: 1
3: 1
4: 50
1002201357_1002201362 0 Left 1002201357 5:177530504-177530526 CCCACAATCAATCATCTCTCCCT 0: 1
1: 0
2: 1
3: 27
4: 376
Right 1002201362 5:177530527-177530549 TGGCCTGCGTTTCCTGCCTGAGG 0: 1
1: 0
2: 2
3: 27
4: 241
1002201357_1002201367 27 Left 1002201357 5:177530504-177530526 CCCACAATCAATCATCTCTCCCT 0: 1
1: 0
2: 1
3: 27
4: 376
Right 1002201367 5:177530554-177530576 GAACTCGAGGTCTTCCTGCCTGG 0: 1
1: 0
2: 3
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002201357 Original CRISPR AGGGAGAGATGATTGATTGT GGG (reversed) Intronic
901949236 1:12728073-12728095 ATGGCTAGATGATTGATTTTGGG + Exonic
902153168 1:14461307-14461329 AGTGAGAGATGATTGAATCATGG + Intergenic
902154713 1:14475601-14475623 AGGGAGAAATGATGGAGCGTGGG + Intergenic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
903031275 1:20466008-20466030 AGAGAGAGGTGATTGAATTTTGG - Intergenic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
905419225 1:37828236-37828258 AGGGAGAGATCATGGCTTTTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907925801 1:58954100-58954122 AGGGAGAGATAATTGAATCATGG + Intergenic
907943380 1:59110140-59110162 AGGCAGAAATGATAGATTTTTGG - Intergenic
908186139 1:61654806-61654828 AGGGAGAGCTGGTGGATTGCAGG + Intergenic
909299221 1:73989992-73990014 AGGGAGTGAAAATTGATTGTTGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910210627 1:84789071-84789093 AGGGGGAGATGATTGACTGATGG + Intergenic
910466216 1:87503071-87503093 AGTGGGAGGTGATTGAATGTTGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
914243265 1:145866999-145867021 AGTGAAAGATGAGTGATGGTAGG - Intronic
915374955 1:155386001-155386023 AGGGAGAGACATATGATTGTTGG + Intronic
915538109 1:156549904-156549926 AGCCAGAGCTGATTGACTGTTGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917645786 1:177027410-177027432 AGGTAGAGATGCTGGATTATGGG - Intronic
918600855 1:186358594-186358616 AAGTACAGATGATTGCTTGTTGG + Exonic
918808510 1:189083167-189083189 AGAGAGAGATGATGGAATGATGG + Intergenic
919330167 1:196160793-196160815 AGGTAGAGAGGATTGAATATAGG - Intergenic
919492330 1:198220331-198220353 TTGGAGAGATGATTGGTTCTAGG - Intronic
920712459 1:208308285-208308307 GGGGAGAGCTAATTGGTTGTAGG + Intergenic
921300323 1:213745618-213745640 AGGGAAGGAGGATTGATTGCAGG + Intergenic
921333333 1:214062385-214062407 AGGGAATGATTATTGCTTGTAGG - Intergenic
922248595 1:223825468-223825490 CAGGTGAGATGATGGATTGTGGG - Intronic
922444362 1:225684142-225684164 AGGGAGAGGTGATTGGCGGTGGG - Intergenic
922909375 1:229202968-229202990 AGGGAGATATGATGCATGGTTGG - Intergenic
923086796 1:230708509-230708531 AGGGAGAGGTGATAGATGGGGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065500060 10:26372018-26372040 AGGGACAGCTGATGGGTTGTAGG - Intergenic
1066636710 10:37510426-37510448 AGTGAGAGATGATTGATTCATGG + Intergenic
1067023262 10:42820472-42820494 AGGGTAAGATGATTGATGGAGGG - Intronic
1067520949 10:47004918-47004940 AGGGAGAGATGAGTGTTAGAAGG - Intergenic
1067538733 10:47136299-47136321 AGAGATAGATGATTTGTTGTTGG - Intergenic
1067719971 10:48720954-48720976 AGGGGGAGATTCTGGATTGTGGG + Intronic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069244481 10:66186315-66186337 AGAGAGAGATGAGTGTGTGTTGG + Intronic
1069298632 10:66878665-66878687 TGAGAGAGATGGTTTATTGTGGG - Intronic
1070268443 10:74927568-74927590 AGGGCTAGGTTATTGATTGTGGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073001973 10:100292614-100292636 AGGAATAGATGAGTGTTTGTGGG + Intronic
1073234399 10:102001456-102001478 AGTGGGAGAGGATTGAGTGTTGG - Intronic
1074372888 10:112914572-112914594 ATGGACGGATAATTGATTGTGGG - Intergenic
1074668882 10:115764763-115764785 AGGGAGAATTGCTTGAATGTGGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075561440 10:123471515-123471537 AGGGAGGGAGGATAGATGGTTGG - Intergenic
1076735530 10:132457384-132457406 AAGGCAAGATGATTGATTGAAGG + Intergenic
1077638617 11:3861145-3861167 AGGCAGAGTTGCTTCATTGTTGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1077933297 11:6755609-6755631 AGGGCCAGATAATTTATTGTGGG + Intergenic
1078629348 11:12988098-12988120 GGAGAGAGATAATTGATTATTGG - Intergenic
1079390823 11:20020752-20020774 AGGGAGAGAGGATACATTGGAGG - Intronic
1079476651 11:20837560-20837582 TTGGAGAGATGGTTGATTTTAGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080807535 11:35668119-35668141 AGGGAGAGTTGGTTTATTGTTGG + Intronic
1081239036 11:40680502-40680524 AGTGGGAGATGATTGAATCTTGG + Intronic
1084789215 11:71462928-71462950 AGGGGGAGATGATAGGGTGTTGG + Intronic
1086434178 11:86764922-86764944 AAGAAGAGATGACTGATTTTTGG - Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1087350820 11:97030024-97030046 AGGGAGAGCTAATGGATTCTGGG - Intergenic
1087811331 11:102612087-102612109 AGGGAGAGATGAGAGACAGTTGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090844359 11:130518583-130518605 AGGGAGTGCTGATTGGTTGGGGG - Intergenic
1090864026 11:130679845-130679867 AGTGGGAGATGATTGAATCTTGG - Intronic
1091851849 12:3705954-3705976 GGTGAGAGCTGATAGATTGTTGG - Intronic
1093612401 12:21178142-21178164 AGGTAGAGATAATTGAATTTTGG + Intronic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1098685543 12:73415386-73415408 AGGGAAAGAAGATTGAGTGGAGG - Intergenic
1099258467 12:80345734-80345756 AGATAGAGATAATTGACTGTAGG + Intronic
1099433691 12:82619067-82619089 AGTGAGAGGTGATTGAATTTTGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099963176 12:89416423-89416445 AGGAAAAGATGCATGATTGTGGG + Intergenic
1100114022 12:91280912-91280934 AGGTAGATATGTGTGATTGTGGG + Intergenic
1100812664 12:98354885-98354907 AGGGAGAGATGTGTGGCTGTTGG - Intergenic
1101079244 12:101165394-101165416 AGGGAGAAAAGATTAATTGAAGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1101904290 12:108813618-108813640 TAGGAGAAATGATTGATTCTGGG + Intronic
1102746703 12:115255266-115255288 AGGCAAAGAAGATTGATGGTAGG - Intergenic
1103160081 12:118721468-118721490 AGGGAGAGTTGATTGTGTATGGG + Intergenic
1103816110 12:123657901-123657923 ATGAATAGATGAATGATTGTTGG + Intronic
1104907042 12:132219106-132219128 AGGGACAGATGATTGTGTGGAGG - Intronic
1105387454 13:19944760-19944782 AGGGAGAATTGCTTGATTCTGGG - Intergenic
1106286965 13:28326495-28326517 AGAGAGAGATTATTGAATGGAGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108213229 13:48159019-48159041 AGGGAGAGATGGTTGACAGAAGG + Intergenic
1109794840 13:67297451-67297473 ATGGACAGCTGATTGATTGAGGG - Intergenic
1110322837 13:74179355-74179377 CAGGAGAGATGATTGCTTCTTGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110649267 13:77924751-77924773 AGTGAGAGATGATTGAATTATGG + Intergenic
1111331744 13:86766883-86766905 AGGTAGAGATGATTGAATCATGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112712898 13:102150871-102150893 GGGGCTAGATGATTAATTGTAGG - Intronic
1114498000 14:23147202-23147224 ATGGATAGATGATGGATGGTTGG - Intronic
1114574867 14:23703044-23703066 AAGGAGATAGGATTAATTGTGGG + Intergenic
1115829745 14:37323758-37323780 AGGCAGAGATGATTGATAGAAGG - Intronic
1116024134 14:39495816-39495838 AGTGGGAGATGATTGAATGATGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117524195 14:56580540-56580562 AGGGAAATATGATTGAGAGTGGG + Intronic
1117608589 14:57459022-57459044 AGGGATAGATGGGTGATTGCAGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1119177895 14:72582811-72582833 ATGGTGTGATGATTGATTTTAGG + Intergenic
1119670445 14:76514287-76514309 AGGGAGATTGGATTGAATGTGGG + Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1122290199 14:100676695-100676717 AGGGTGGGTTGATAGATTGTGGG - Intergenic
1122386384 14:101351126-101351148 TGGGAGAGATGAATGAATGTGGG - Intergenic
1202881693 14_KI270722v1_random:66676-66698 AGGTAGATTTGATTGTTTGTTGG + Intergenic
1123424416 15:20157653-20157675 AGGGTAAGATGATTGATGGAGGG - Intergenic
1123533639 15:21164184-21164206 AGGGTAAGATGATTGATGGAGGG - Intergenic
1125230080 15:37444343-37444365 AGGGACAGATGAATAATTTTAGG - Intergenic
1126926337 15:53591428-53591450 AGGCAGATATGATTGACTTTTGG - Intronic
1126931152 15:53652849-53652871 AGGGAGAAATGATTCACTTTGGG - Intronic
1128636497 15:69305713-69305735 AGGGAGAGAGGGTGGAGTGTGGG + Intronic
1131607320 15:93920652-93920674 CAGGAGAGATGATTGATAGATGG + Intergenic
1131914686 15:97251934-97251956 AGGGGGAGATGATTGAATCATGG + Intergenic
1134019630 16:10912560-10912582 AGGGAGAGCTGATAGCTTGTGGG - Intronic
1134140768 16:11716541-11716563 AGTGCTAGATGATTAATTGTGGG - Intronic
1134869420 16:17638400-17638422 AGGGGGAGATGATTGAATCATGG - Intergenic
1137912750 16:52394966-52394988 AAGTATAGATGATTTATTGTTGG - Intergenic
1138369703 16:56517037-56517059 AGGCAGGAATGCTTGATTGTAGG - Intronic
1138746862 16:59373348-59373370 AGGGAGAGAGGATCGATGGAAGG - Intergenic
1139959255 16:70708325-70708347 TGGGGGAGATGAATGCTTGTAGG + Intronic
1140338630 16:74135771-74135793 AGGTGGAGATGAATGAATGTTGG + Intergenic
1141074348 16:80989555-80989577 TTGGAGAAATGACTGATTGTAGG - Intronic
1141882742 16:86870631-86870653 ATGGAGAGATGATTCAGTCTTGG + Intergenic
1142960511 17:3549618-3549640 ATGGAGAGATGATAGAATGAGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143671739 17:8401208-8401230 AAAGATAGATGATTGATTGATGG - Intergenic
1144352401 17:14409911-14409933 AGTGGGAGATGATTGAATTTTGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145296381 17:21595853-21595875 TGGGAGAGATGCTTGAGTCTGGG + Intergenic
1149126195 17:53236448-53236470 GGGGATATATGATTGCTTGTTGG - Intergenic
1149364091 17:55923238-55923260 AGGGAGAAATGAATTATTCTGGG - Intergenic
1149619160 17:58029174-58029196 TTGGAAAAATGATTGATTGTAGG + Intergenic
1150752118 17:67873905-67873927 TTGGAGAGATGGTGGATTGTAGG + Intronic
1152473755 17:80504256-80504278 ATGGAGGGATGATGGATGGTAGG + Intergenic
1152512780 17:80801809-80801831 AGGGGGAGGTGAGTGATTGGCGG + Intronic
1152731510 17:81973969-81973991 TGGGAGAATTGCTTGATTGTGGG - Intergenic
1153676977 18:7464547-7464569 AGGGAGAGATCATTTCTTATTGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156001479 18:32389711-32389733 AGGGAGACATAAATGATTTTTGG + Intronic
1158983022 18:62783784-62783806 GGGGTGAAATGATTGACTGTAGG + Intronic
1159341756 18:67142974-67142996 AGGGAGGGATGGATTATTGTGGG + Intergenic
1159539701 18:69760046-69760068 GGGGATAGATGGTTGATAGTAGG + Intronic
1160284338 18:77526206-77526228 AGGGGGAGATAATTGATTCACGG + Intergenic
1161899195 19:7105182-7105204 AGGGATAGATGATGGATGGATGG + Intergenic
1162211627 19:9096464-9096486 AGGCAGAGGTGTTTGATTATGGG + Intergenic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1163164170 19:15483932-15483954 GGGTAGAGGTGATTCATTGTGGG - Intronic
1163383664 19:16985777-16985799 AGGGAGAGAGGATAGATGGATGG + Intronic
1163417752 19:17196793-17196815 AGGTAGAGATGATGGATGGCTGG + Intronic
1166933857 19:46319290-46319312 AGGGAGGGTTTATTGAGTGTGGG + Intronic
1167376795 19:49116630-49116652 AGAGAGAGAAGGTTGAGTGTAGG - Intronic
1168676013 19:58278693-58278715 CCCGAGAGATGACTGATTGTGGG - Intronic
1202657301 1_KI270708v1_random:35773-35795 AGGTAGATTTGATTGATTGGTGG + Intergenic
925257384 2:2501719-2501741 AGGGAGGGATGTTTGAGTGAGGG + Intergenic
926950200 2:18234511-18234533 AGAGAGAGATGATAGATAGGTGG - Intronic
927403717 2:22743794-22743816 ACCCAGAGATGATTGATTGATGG + Intergenic
928026675 2:27745424-27745446 ATGAATAGATGATTGATTGATGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928858962 2:35832791-35832813 AGGGAGAGATAATTGGTTAAGGG + Intergenic
929724822 2:44414136-44414158 AGCCAGAGGTGATTGCTTGTAGG + Intronic
929726898 2:44439291-44439313 AGAGAGAGAGGATTAATTGTAGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932850302 2:75178136-75178158 AGTGAGGGATGAATGAATGTAGG - Intronic
933207277 2:79521642-79521664 AGGAAGAGGTAAATGATTGTTGG + Intronic
933861561 2:86474569-86474591 AGGGAGAGTTGCTTGAATTTGGG + Intronic
934690623 2:96355950-96355972 AGGGAGAAATGATAGGTTGATGG + Intronic
937282211 2:120726362-120726384 TTGGAGAAATGATTGATTCTAGG - Intergenic
938200020 2:129365076-129365098 AGGTAGATATGTTTGATCGTAGG - Intergenic
938240415 2:129738788-129738810 AGGGAGAGAAGATTGGTTCCTGG - Intergenic
940408651 2:153334951-153334973 AGGGAGAGATAATTGAATCATGG + Intergenic
941320039 2:164042485-164042507 AGTGAGAGATGATTGAATAATGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942426370 2:175864673-175864695 AGGGTGAATTGATTGAGTGTGGG + Intergenic
943072052 2:183153141-183153163 AGGGAGAGGTAATTGATTCATGG - Intronic
943145736 2:184042787-184042809 AGGGAGAGATAATTGAATCATGG + Intergenic
943625232 2:190190956-190190978 AGGGACAGATGATAGATTAGTGG - Intronic
944214100 2:197236677-197236699 AGGGAGAGATGAGTAGTTTTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944827851 2:203503499-203503521 AGGGGGAGATAATTGAATCTTGG - Intronic
945802365 2:214449442-214449464 TGGGAGAAAAAATTGATTGTAGG + Intronic
946670855 2:222102631-222102653 AGGGAAAGATAATTGCCTGTTGG + Intergenic
948187205 2:236030744-236030766 AGGGAGAAATGCTTAAGTGTTGG + Intronic
948384736 2:237574539-237574561 ATGGAGCGATGACTGACTGTGGG - Exonic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169803210 20:9532603-9532625 AGAGAGAGATGATGGTTTGGAGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170772852 20:19349238-19349260 AAGGAGAGAGGATTGCTTGAGGG - Intronic
1172151832 20:32796266-32796288 AGGTAGGGATGCTTGTTTGTGGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174422133 20:50406116-50406138 AGGCAGATATGATGGATGGTAGG - Intergenic
1174678870 20:52384995-52385017 AGGGAGAATTGCTTGATCGTGGG + Intergenic
1174935235 20:54860658-54860680 AGGGACACATCATTGATGGTAGG + Intergenic
1175984173 20:62755763-62755785 AGGGAGAGATGATGGCTGGAGGG - Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1178028599 21:28497077-28497099 AGGTAGAGATAATTGATTCATGG - Intergenic
1178166947 21:29990001-29990023 ATGGAGAGATTAGTGTTTGTTGG + Intergenic
1179065262 21:38018613-38018635 AGTGAGAGATGATTGAATCATGG + Intronic
1180376307 22:12096979-12097001 AGGGAGATTTGATTGATTGATGG + Intergenic
1180421272 22:12816719-12816741 AGGTAGATTTGATTGATTGATGG - Intergenic
1181134547 22:20755386-20755408 ATGGAGAAATGGTTGATTCTAGG - Intronic
1181357380 22:22307069-22307091 AGGGTAAGATGATTGATGGAGGG - Intergenic
1181850431 22:25745882-25745904 AGGTAGAGATGGTTGCTTGATGG + Intronic
1182155586 22:28069725-28069747 AGGGATAGATAATTAATAGTTGG - Intronic
1185018786 22:48361103-48361125 ATGGATAGATGATGGATGGTTGG + Intergenic
949448707 3:4163246-4163268 AAGGAGAGATAATTGGTTGTTGG - Intronic
949597661 3:5564942-5564964 AGGGAGAGATATTTGTTTCTTGG + Intergenic
950833685 3:15899629-15899651 AGGGAGGCATGAGTGATTGGGGG + Intergenic
950937619 3:16857069-16857091 AGAGACAAATGATTGATTCTGGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951166987 3:19494303-19494325 AGTGAGAGATGATTGAATCATGG + Intronic
951416113 3:22423358-22423380 AGGGAGAGATGATGGCATCTGGG + Intergenic
951523252 3:23629123-23629145 AGGGAGAGAAGATTGGGTGAAGG + Intergenic
951614731 3:24529800-24529822 AGAGAGAAATGACTGATTCTAGG - Intergenic
952979340 3:38722417-38722439 GGGGAGAGGTGACTGATGGTGGG + Intronic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
953824591 3:46239996-46240018 AGGGAGATAAGATTGACTGCTGG - Intronic
954377960 3:50204903-50204925 AGTGAGAGATGCTTGAATGGGGG - Intergenic
955171943 3:56574569-56574591 AGGGAAAGAAGTTTGGTTGTAGG + Intronic
955190422 3:56756493-56756515 AGGAAGAGAAGATTGTTTGAAGG - Intronic
955249861 3:57269260-57269282 AGTGAGAGATGATTGATGATGGG + Exonic
957210481 3:77251675-77251697 AGGGGGAGATGATTGAATCACGG + Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958149265 3:89669676-89669698 AGTGAGAGATGATTGAATCATGG + Intergenic
958174210 3:89974591-89974613 AGTGGGAGATAATTGATCGTGGG + Intergenic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959146449 3:102551582-102551604 AGGGAGAGATAATTGGGGGTTGG - Intergenic
959384388 3:105684175-105684197 ATGGAGAGATGCTGGAATGTAGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963563537 3:146898441-146898463 AGGGAGAGATAATTGAGATTGGG + Intergenic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964936852 3:162100007-162100029 AGAGAGAGGTGGTTGGTTGTTGG + Intergenic
967396181 3:189011653-189011675 AGTGGGAGATGATTGATTCATGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969198032 4:5578712-5578734 AGAGAGAGATAATAGATTGGGGG + Intronic
971460628 4:26891938-26891960 AGTGGGAGATGATTGAATCTTGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972256645 4:37363182-37363204 AGGGAAAGATTATACATTGTCGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972935980 4:44136174-44136196 AGTGGGAGATGATTGAATCTTGG + Intergenic
973112644 4:46414397-46414419 AGAGAAAGAGGATTAATTGTAGG + Intronic
973724875 4:53764984-53765006 AGGGAGATGTGATTAATTGCTGG - Intronic
974828485 4:67160044-67160066 AGGGAGGGAAAATTGATTGGAGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976794043 4:88912532-88912554 AGAGAGAGGTGATTTATTATGGG - Intronic
976920287 4:90432680-90432702 GGGGAGGATTGATTGATTGTGGG - Intronic
977037048 4:91967416-91967438 TTGGAGAAATGATTGATTTTAGG + Intergenic
977825112 4:101522132-101522154 AGGGAAAGATGATCTATGGTAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979215297 4:118156386-118156408 AGGTAAAGATAATTGATTATAGG - Intronic
979548890 4:121968033-121968055 AGTGACATATGATTGATTATAGG + Intergenic
979823727 4:125206345-125206367 AAGGAGTGATGAGAGATTGTGGG + Intergenic
980494837 4:133577231-133577253 AGTGGGAGGTGATTGATTCTTGG + Intergenic
980732359 4:136839412-136839434 AAGGAGGGATGATGGATTCTGGG - Intergenic
982406962 4:155031601-155031623 AGGGAGAGATGACAGAGTTTTGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
983642298 4:169954370-169954392 ATGGAGAGATGATGGTTTCTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983818291 4:172160040-172160062 AGGGAGAAATGATTTACTGGAGG + Intronic
984090353 4:175366040-175366062 AGAGAGAGATAATAGACTGTAGG - Intergenic
985165169 4:187086200-187086222 AGGAAGAGAGGACAGATTGTTGG - Intergenic
985587268 5:746993-747015 AAGGAGAGATGATGAATTCTGGG + Intronic
985601818 5:839085-839107 AAGGAGAGATGATGAATTCTGGG + Intronic
985806324 5:2046443-2046465 AGGGAGAGATGATGAATTAATGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986636814 5:9830551-9830573 ATAGAGAGATGATAGATGGTTGG + Intergenic
987359392 5:17093014-17093036 AGAGAGAGATGAATGAATGAGGG + Intronic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
989997120 5:50849259-50849281 AGGAAGAGATGTTTGTTTGGAGG - Intergenic
990583509 5:57187819-57187841 AGGGAGAGATTATGAATTGGAGG + Intronic
990850480 5:60197649-60197671 AGGGAGAAATGATAGCTTGAGGG - Intronic
991450287 5:66743875-66743897 AGAGAGAGATGATTGGTCTTTGG + Intronic
992303126 5:75405592-75405614 AGGGTGTGATGATTGAATGAGGG - Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994534736 5:101014613-101014635 TGGGATAGACTATTGATTGTAGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996883332 5:128326293-128326315 AGGGAGAGAAGATTGAGAATGGG + Intronic
997139166 5:131360670-131360692 AGGTATACATGATTGATTGTTGG + Intronic
1001439199 5:171725884-171725906 AGGGTGAGATGACTGATGGATGG - Intergenic
1002022265 5:176371440-176371462 AGGGAGAGAGCATTGAGTTTAGG + Intronic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1002442042 5:179269557-179269579 AGTGAGAGATGATTGAATCATGG - Intronic
1003649017 6:7941200-7941222 AGGGAGAGAAGATTGTTTAAAGG - Intronic
1005490337 6:26341966-26341988 AGGAAGAGATGATAGAGTGAGGG + Intergenic
1005583713 6:27256239-27256261 AGGGAGTGATATTTGATTGTGGG - Exonic
1007743746 6:44029595-44029617 AGGGCAAGATGACTGATTTTTGG - Intergenic
1008212718 6:48744975-48744997 AAGCAGAGGTTATTGATTGTAGG + Intergenic
1009242570 6:61199616-61199638 AGGTAGAGATAATTGAATGCTGG + Intergenic
1009533109 6:64845512-64845534 AGAGAGAGATTATTTTTTGTTGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009876528 6:69512461-69512483 AGTGAGAGATGATTGAATCATGG + Intergenic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010275807 6:73967190-73967212 AGTGGGAGATGATTGAATGATGG + Intergenic
1011587694 6:88944523-88944545 AGGAAGAAAGGATTGATTGGTGG - Intronic
1014022096 6:116603097-116603119 AGGGAGAGATAATTGAATCGTGG - Intergenic
1014307727 6:119763394-119763416 TGGTAGAGTTGATTGATAGTAGG + Intergenic
1014483589 6:121970279-121970301 AGGCAGAGATCATTGACGGTAGG - Intergenic
1014770949 6:125457802-125457824 AGGGAGAGATAATTGAATCATGG - Intergenic
1015049176 6:128818265-128818287 AGGTAGAGATAATTGATTCATGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015940162 6:138441786-138441808 AGAGAGAGTTGATTGAATTTTGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017611281 6:156188941-156188963 AGAGAGAGATGATTCTTTGAAGG + Intergenic
1017617519 6:156260768-156260790 AGAGAGAGATGATTGGATGCTGG + Intergenic
1018029176 6:159828469-159828491 GGGGAGAGATGATTGATTACAGG - Intergenic
1018092934 6:160361145-160361167 ATGGGGAGAGGATGGATTGTTGG + Intronic
1018181313 6:161225987-161226009 AGGGAGAGATGATCAGTTTTAGG + Intronic
1018437852 6:163779050-163779072 ATGGAGAGATGATAGATGGTAGG - Intergenic
1019480779 7:1265748-1265770 AGGGAGAGATTGTTTATGGTTGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020894478 7:13922634-13922656 AGGGAGAAATTATTGATCATGGG + Intronic
1022479739 7:30734876-30734898 GGGGAGAGATGATGGTTTGGGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022771315 7:33475792-33475814 AGAGCGAGAGGAATGATTGTTGG + Intronic
1023469666 7:40501625-40501647 AGGAAGGGATGATTGAATGAAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025248696 7:57337333-57337355 AGGTAGATATGATGGATGGTAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1032492852 7:132337164-132337186 GGGGAGAAATTATTGAATGTTGG - Intronic
1032520688 7:132541770-132541792 AGGCAGAGATGATAAGTTGTGGG + Intronic
1032764168 7:134975092-134975114 AGGGGGAGATAATTGAATCTTGG + Intergenic
1032953841 7:136947983-136948005 AGGGAGAGATGACTTCTGGTGGG + Intronic
1033048267 7:137981645-137981667 AAGGAGGGATGAATGAATGTGGG + Intronic
1033232030 7:139606782-139606804 GGGGAGAGACTATTGAATGTGGG - Intronic
1033290752 7:140080781-140080803 AGGGAGAGATAATTGATGCTGGG - Intergenic
1033595991 7:142858169-142858191 AGGTAGAAATGAAGGATTGTAGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035299798 7:157889429-157889451 AGGGAATGCTGATTGGTTGTTGG - Intronic
1035330250 7:158092001-158092023 AGGGATAGGTGATAGATGGTTGG + Intronic
1039358794 8:36851276-36851298 GGTGAGAGGTGATTGATTATGGG + Intronic
1042498137 8:69478644-69478666 AGAGAGAGATTATTGATGGTTGG - Intronic
1043481887 8:80661808-80661830 AGGGAGAGATGTTGGTTAGTAGG + Intronic
1044271501 8:90249793-90249815 AGGAAGAGATGCTTGAGTTTTGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046261928 8:111780009-111780031 AGGGAGCAAAAATTGATTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046855630 8:119028588-119028610 AGGGGGAGGTGATTGAATGATGG - Intronic
1049043446 8:140129978-140130000 CTGGAGAGATGACTGATTGCAGG + Intronic
1050797821 9:9567233-9567255 ATGCAGAGATGATTGATTGTGGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051771538 9:20584701-20584723 AGGGGGAGATAATTGAATCTTGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054274711 9:63055886-63055908 AGGGTAAGATGATTGATGGAGGG - Intergenic
1054300568 9:63376113-63376135 AGGGTAAGATGATTGATGGAGGG + Intergenic
1054400114 9:64709044-64709066 AGGGTAAGATGATTGATGGAGGG + Intergenic
1054433703 9:65193304-65193326 AGGGTAAGATGATTGATGGAGGG + Intergenic
1054496682 9:65828365-65828387 AGGGTAAGATGATTGATGGAGGG - Intergenic
1054943834 9:70773115-70773137 AGGGAGAGAAGATGGAATCTGGG + Intronic
1056185249 9:84128429-84128451 AGGGAGAGTTGTTTGAGTGTGGG - Intergenic
1056373838 9:85987185-85987207 ATGGTTAGAGGATTGATTGTTGG + Intronic
1058754960 9:108075711-108075733 AGGGAGACAGCATTGATTCTGGG + Intergenic
1059175671 9:112168013-112168035 AGGGAGAGATGATTCAATCATGG - Intronic
1059275775 9:113095855-113095877 AGGGAGAGAGGATTCAGGGTGGG - Intergenic
1059389838 9:113992176-113992198 AGGGTGGCATGATTGATTGTTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1061950649 9:133934044-133934066 ATGGACAGATGAATGATTGATGG + Intronic
1061957264 9:133970160-133970182 AGGGAGAGATGGTTGAGACTCGG - Intronic
1203689509 Un_GL000214v1:29427-29449 AGGTAGATTTGATTGATTGATGG + Intergenic
1203538695 Un_KI270743v1:67283-67305 AGGGAGATTTGATTGATTGATGG + Intergenic
1203556125 Un_KI270743v1:209240-209262 AGGTAGATTTGATTGATTGATGG - Intergenic
1203646766 Un_KI270751v1:74626-74648 AGGTAGATTTGATTGATTGATGG - Intergenic
1185861785 X:3586458-3586480 TGGGAGAGATGTTTCATCGTTGG + Intergenic
1186266792 X:7842357-7842379 AGAGAGGGATGATTGATTGACGG + Intronic
1187476495 X:19615593-19615615 AGGCAGAGATGAGTGCTTCTGGG - Intronic
1187915032 X:24145752-24145774 AGGGAGAAGTGATTGATTCCAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188793207 X:34430648-34430670 TTGGAGAGATGACTGATTATAGG - Intergenic
1189271008 X:39751939-39751961 AGGGAGAGAGCTTTGATTCTTGG - Intergenic
1189357421 X:40321797-40321819 TGGGAGACATGATTCATTGGGGG - Intergenic
1189845882 X:45138071-45138093 AAGGAGAGATGAGAGATTGCTGG - Intergenic
1191007686 X:55727922-55727944 AGGGAGAGATGATGGTAAGTAGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1194216109 X:91132403-91132425 AGTGGGAGATGATTGATTCATGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196285708 X:113877253-113877275 ATGGAGAAATGGCTGATTGTAGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196780096 X:119376032-119376054 AGGGAGAGTTTATTGATTTGGGG + Intergenic
1196990977 X:121328379-121328401 AGGGATTGAGGATTGATTGGAGG - Intergenic
1198772293 X:140143873-140143895 AAGCAGAGATGGTTGAGTGTAGG + Intergenic
1199325311 X:146492217-146492239 AGGGAGAGATAATTGAATCATGG + Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199519592 X:148720387-148720409 ATGGATATATGATTGATTGAAGG - Intronic
1201344565 Y:12968310-12968332 AGTGGGAGATGATTGAATCTTGG - Intergenic