ID: 1002202630

View in Genome Browser
Species Human (GRCh38)
Location 5:177538824-177538846
Sequence GGCTGTTCCCTGTCCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002202630_1002202635 -6 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202635 5:177538841-177538863 ACAGCCTGACTTCCTTGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 193
1002202630_1002202633 -10 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202633 5:177538837-177538859 GGGAACAGCCTGACTTCCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1002202630_1002202638 12 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202638 5:177538859-177538881 GGAGGAGCCCTCCTGCATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1002202630_1002202634 -9 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202634 5:177538838-177538860 GGAACAGCCTGACTTCCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 188
1002202630_1002202643 27 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202643 5:177538874-177538896 CATTCAGGGACCCCTGTCAGCGG 0: 1
1: 0
2: 3
3: 20
4: 158
1002202630_1002202639 13 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202639 5:177538860-177538882 GAGGAGCCCTCCTGCATTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002202630 Original CRISPR GGCTGTTCCCTGTCCTCAGG TGG (reversed) Intronic
900214501 1:1474139-1474161 TGCAGTCCCCTCTCCTCAGGAGG - Intronic
900872383 1:5313214-5313236 GGCTGCTCCCTGTTCTCCAGGGG - Intergenic
902961663 1:19967965-19967987 GGATGTTCCCACTCCTCATGTGG - Intergenic
902988780 1:20171612-20171634 GGTAGTTCCCTGACCTCAGGAGG + Intronic
903061656 1:20672815-20672837 GGCAGTCACCTGTGCTCAGGAGG - Intronic
903446413 1:23425004-23425026 GGCTGTGACCTGGCCACAGGCGG + Intergenic
904312912 1:29640802-29640824 GGTCCTTCCCTATCCTCAGGAGG + Intergenic
905730849 1:40298587-40298609 GGCAGGTCCCTGTTCTCAGTAGG + Intergenic
906726512 1:48048411-48048433 GGGTGTGCTCTGTCCTCAGTAGG + Intergenic
907437861 1:54461031-54461053 GGCTGTTGCCTTTGCCCAGGCGG - Intergenic
908639904 1:66211059-66211081 TGCTGTGCTCTGTCATCAGGAGG - Intronic
908662722 1:66454513-66454535 TGCTGATCCCTGTCCTCCGTGGG + Intergenic
913481574 1:119294074-119294096 TGCAGTTCCCTGTTCCCAGGCGG + Intergenic
916003985 1:160642761-160642783 GGCACTTCCATGTCCTCAGCTGG - Intronic
916254063 1:162768428-162768450 TCCTATTCCCTGCCCTCAGGAGG - Intronic
917453092 1:175163462-175163484 GGCTGTTCCCAGGCCTCAGAGGG - Intronic
917674326 1:177304947-177304969 GGCTGTTCCCAGTCCCAAGGTGG + Intergenic
920207301 1:204301759-204301781 TGCTGTTTCATGGCCTCAGGAGG + Intronic
921595639 1:217051145-217051167 AGCAGTTACGTGTCCTCAGGTGG + Intronic
922824776 1:228510261-228510283 GGCAGGTCCCTGTCCTCACATGG - Intergenic
923136651 1:231125807-231125829 GGCAGTGCCCTGTACTCTGGGGG - Intergenic
923354281 1:233138497-233138519 GGCTCTACCTTGTTCTCAGGGGG + Intronic
924208168 1:241736058-241736080 GGCTGTGCTCTGTCCTTATGTGG - Intronic
924508517 1:244709336-244709358 GTCTGTTCCCTGCACTCTGGGGG - Intergenic
924766749 1:247039492-247039514 GGCTGTGGCCTTTACTCAGGAGG - Exonic
1062988167 10:1789578-1789600 GGCTGTTCCGCATCCCCAGGAGG - Intergenic
1063817122 10:9788168-9788190 GCCTTTTCCCTGGCCTCTGGTGG + Intergenic
1064011193 10:11737821-11737843 CGCTGTTCCCTGACCTCACTGGG + Intergenic
1065426938 10:25615800-25615822 TACTCTTCCCTCTCCTCAGGAGG + Intergenic
1067274382 10:44821087-44821109 TGTTGTTCCCTGTACTCAGATGG + Intergenic
1067851952 10:49760042-49760064 GGCTGTGCCCTGCCCTCTGGTGG - Intronic
1069109534 10:64428281-64428303 AGCTGTTCTCTGTCCTCACATGG - Intergenic
1069779477 10:70945783-70945805 GGCTGTCCCCTGCCCTCAAGGGG + Intergenic
1069832337 10:71289007-71289029 GGCTGTCCTCTTTCCTCTGGGGG + Intronic
1070064369 10:73018772-73018794 GGCTGTGCCCTGTCCACCAGGGG + Intronic
1070739958 10:78896368-78896390 GGCTGCTCCTTCTCCTAAGGGGG + Intergenic
1071244662 10:83749922-83749944 GGCTGTGCAGTGTCCTCGGGAGG + Intergenic
1072321725 10:94256764-94256786 TGCTGATCCCTGTCCTCCTGGGG - Intronic
1072797296 10:98365830-98365852 GGCTGTGGCCAGGCCTCAGGAGG - Intergenic
1073129580 10:101178591-101178613 GGCTGGGCCCACTCCTCAGGAGG - Intergenic
1073302695 10:102480589-102480611 GGCTGTGCTCCCTCCTCAGGTGG - Exonic
1074115945 10:110457665-110457687 CCCTCTTCCCTGTCCCCAGGTGG + Intergenic
1076470701 10:130716274-130716296 TGCTGTTCCCTGTCCCCAAAGGG + Intergenic
1076519904 10:131075024-131075046 GACTCTTCCCTGTCATCGGGTGG + Intergenic
1076774382 10:132686231-132686253 GGCTGTGCCGTGGCCTCCGGGGG + Intronic
1077170180 11:1162603-1162625 GGCTGGGCCTTGTCCTCATGTGG + Exonic
1079244408 11:18742436-18742458 GACTGGCGCCTGTCCTCAGGGGG + Exonic
1080036671 11:27719114-27719136 GGCAGTTCGCTGTCCCCCGGGGG + Intronic
1081424209 11:42907167-42907189 ATCTGTTCTCTGTCCTCAAGAGG + Intergenic
1081531027 11:43959524-43959546 GGATGTTCCCTGTCAGCAGTGGG + Intergenic
1081704606 11:45173843-45173865 GGGAGTTCCTTGCCCTCAGGAGG + Intronic
1084579664 11:70015362-70015384 AGGTGCTCCCTGCCCTCAGGGGG + Intergenic
1084809613 11:71604207-71604229 GGATGTTCCCTGCCCACAGATGG + Intergenic
1086912627 11:92490788-92490810 GCCTGTTCCCAGTCTTCTGGAGG + Intronic
1088118559 11:106340528-106340550 TACTCTTCCCTTTCCTCAGGTGG + Intergenic
1091174257 11:133545662-133545684 GGCTGTTCCCTGGCCTCTATGGG - Intergenic
1091345880 11:134853680-134853702 GTCTGTTTCCTCTCTTCAGGTGG - Intergenic
1091460360 12:639737-639759 GGCTGGAACCCGTCCTCAGGAGG - Intronic
1091587278 12:1823420-1823442 GGCTGTTCCGTGCTCTGAGGGGG + Intronic
1092843509 12:12564194-12564216 CACTGCTCCCTGTCCTCTGGTGG + Intergenic
1093483777 12:19631163-19631185 GGCAGGTACCTGTACTCAGGAGG - Intronic
1095289567 12:40462657-40462679 GGCGGGTGCCTGTACTCAGGAGG - Intronic
1096103817 12:48985366-48985388 GGCTGTGCACAGTCCCCAGGGGG + Intergenic
1096386639 12:51198903-51198925 GGCTCTTCCCCATCCTCATGTGG - Intronic
1096567634 12:52494628-52494650 GGGTGTTCCCTGTCTAAAGGAGG + Intergenic
1096745800 12:53726091-53726113 GTCTGTTCCCTGCCCTGGGGTGG - Intronic
1096915990 12:55034349-55034371 GGCTGTTCCCGGCCCTCAGTGGG - Intergenic
1097096996 12:56557509-56557531 GACTGGTCCCTCTCATCAGGAGG - Intronic
1101568532 12:105932359-105932381 GGCTGCTCCCGGTGCTAAGGTGG - Intergenic
1104607496 12:130200713-130200735 GCGTGTTCCCTGTCCTCATCAGG - Intergenic
1106100374 13:26690132-26690154 GGCTGGGCCCTGCCCTCATGGGG + Intergenic
1113065696 13:106372408-106372430 GTCTGTTTCCTGTCTGCAGGAGG - Intergenic
1113640829 13:111955567-111955589 GGCTGTCCCCTCCGCTCAGGTGG + Intergenic
1113758511 13:112831356-112831378 TGCTGTGCCCTGCCCGCAGGTGG + Exonic
1114711831 14:24786546-24786568 TGCTATTCACTGTCTTCAGGTGG + Intergenic
1116873158 14:50086633-50086655 GGCTGTCCCATGGCATCAGGTGG + Intronic
1117052017 14:51869934-51869956 GGCTGCTCCATGGCCTCGGGAGG - Intronic
1118731908 14:68672899-68672921 GGTTGCTGCCTGTCTTCAGGGGG - Intronic
1119434058 14:74586458-74586480 GGCCGCTGTCTGTCCTCAGGGGG - Intronic
1119434647 14:74589970-74589992 GGCTGTTCTCAGGGCTCAGGAGG - Intronic
1119739392 14:77004348-77004370 AGCTCTTCCCTGGGCTCAGGTGG - Intergenic
1119975957 14:79023920-79023942 GGCTGTTCCCTCTGCACAGAAGG - Intronic
1121017452 14:90557136-90557158 TGCTTCTACCTGTCCTCAGGTGG + Intronic
1121095336 14:91214491-91214513 GGCTGTTTCCTGCCCTCTGAGGG + Intronic
1121575758 14:94985258-94985280 GACTTTTTCCTGTTCTCAGGGGG - Intergenic
1121970497 14:98351503-98351525 GGTGGTTCCCTGTTCTCGGGAGG + Intergenic
1122411390 14:101527807-101527829 ACCTGTTCCGTGTCCTGAGGGGG - Intergenic
1122892520 14:104739388-104739410 GGCTGTTCCCTGTACTCCAGTGG - Intronic
1123053517 14:105559087-105559109 TGCTGTCCTCTGTGCTCAGGAGG + Intergenic
1123078094 14:105679501-105679523 TGCTGTCCTCTGTGCTCAGGAGG + Intergenic
1126755519 15:51921603-51921625 GTCTGATACCTGTACTCAGGTGG - Intronic
1127857689 15:62966245-62966267 AGATGGTCCCTGTCCACAGGGGG - Intergenic
1127920525 15:63490788-63490810 TGCTGTTCCTTGTCCTCACCAGG - Intergenic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1127957642 15:63866897-63866919 GGCGGGTGCCTGTACTCAGGAGG - Intergenic
1128333513 15:66771508-66771530 GGCTGTACCCAGCCCTCTGGAGG - Intronic
1129707989 15:77805525-77805547 GACTGTGGCCTGCCCTCAGGGGG + Intronic
1132036618 15:98490707-98490729 GGCTCTTCTCAGTCCTTAGGTGG - Intronic
1132065475 15:98727591-98727613 GGCTGTCACCTGAGCTCAGGTGG + Intronic
1132639816 16:972643-972665 GGCCCTGCGCTGTCCTCAGGTGG + Intronic
1132709641 16:1260632-1260654 GTGTGTTTCCTGTCCTCTGGGGG - Intergenic
1132876931 16:2144150-2144172 GACAGGGCCCTGTCCTCAGGAGG + Intronic
1132945740 16:2530700-2530722 GGCTGTTCCCTTCCAACAGGTGG - Exonic
1134093435 16:11403673-11403695 GGCTCTGCTCTGTGCTCAGGAGG + Intronic
1138590345 16:57996166-57996188 GGCTTCTCCCTGCCCTAAGGAGG - Exonic
1139483691 16:67244746-67244768 GGCTGTGTCCTGTCCTCTGCTGG + Intronic
1139729613 16:68931974-68931996 GGCTGATGCCTGTACTCAGGAGG - Intronic
1140105003 16:71951820-71951842 GGCCGTTCCCTTTCGTCAGAAGG + Intronic
1141510608 16:84509587-84509609 GGCTGTTCTGTGTCCCAAGGGGG - Intronic
1141560514 16:84864744-84864766 GGCTGGCCCCTGGCCTCTGGAGG + Intronic
1141991658 16:87614316-87614338 GGCAGGTCCCTGTACACAGGAGG + Intronic
1141991669 16:87614365-87614387 GGCAGGTCCCTGTACACAGGAGG + Intronic
1141991680 16:87614414-87614436 GGCAGGTCCCTGTTCACAGGAGG + Intronic
1142473316 17:175553-175575 GCATGGTCCCTGTGCTCAGGGGG - Intronic
1142806040 17:2371784-2371806 GGCTGCTGAGTGTCCTCAGGTGG - Intronic
1143409131 17:6697975-6697997 AGGTGCTCCCTGGCCTCAGGTGG + Intronic
1143544714 17:7589260-7589282 GCCTCTTCCCTGTCCGCAGCGGG + Exonic
1143849338 17:9798139-9798161 GGCTCTGCCCTGCCCTCAAGGGG - Intronic
1144358556 17:14469458-14469480 GGCTGTCCTCCTTCCTCAGGTGG + Intergenic
1144516330 17:15919676-15919698 GGCTGTCTCCTGACCTCAGGAGG - Intergenic
1145940347 17:28740374-28740396 TGCTGTTCCCTCCCCTCAGTGGG + Intronic
1146897479 17:36554760-36554782 GGCTGTATCCTGTTCTCAGAGGG + Intronic
1147533980 17:41306348-41306370 GCCTATTCCTTGTCCTCAAGGGG - Intergenic
1147559723 17:41501404-41501426 GGCCCTGCCCTGTCCTGAGGTGG - Intronic
1148763513 17:50022023-50022045 GTCTGATCCCTTTCTTCAGGTGG + Intergenic
1150610953 17:66732727-66732749 GGTTGTTTCCTGTCTTCAGAGGG - Exonic
1152029689 17:77834393-77834415 AGCTGCACCCTGTTCTCAGGAGG + Intergenic
1152084941 17:78212261-78212283 AGCAGTTGCCTGCCCTCAGGAGG - Intergenic
1152176652 17:78792408-78792430 GGCTGTTCCCCATCCTCTGTGGG - Intronic
1155209943 18:23591976-23591998 AGCTGTTCCCTGTGTTCAGCTGG - Intergenic
1156883286 18:42105933-42105955 AGCTGTTCCCTTTCCTCTGGTGG + Intergenic
1157067960 18:44374006-44374028 GGCTGTGCACTGTTCCCAGGTGG + Intergenic
1157740821 18:50091093-50091115 TGCCCTTCCCTGTCTTCAGGTGG - Intronic
1159369757 18:67516075-67516097 GCCGAGTCCCTGTCCTCAGGTGG + Intronic
1159764595 18:72473028-72473050 GGCTTGTCCATGTCCTCAGAGGG - Intergenic
1160415916 18:78710798-78710820 GGGTGTGCCCTGCCCCCAGGCGG + Intergenic
1162561846 19:11421829-11421851 GGCTCTACCCTGGCCGCAGGAGG - Exonic
1163003896 19:14385551-14385573 GGCGGTTCCCAGCACTCAGGGGG - Intronic
1163620545 19:18357304-18357326 GCCTTTTCCCTGGCCTCAGGGGG + Intronic
1164011291 19:21205354-21205376 GGACATTCCCTTTCCTCAGGTGG + Intergenic
1164232956 19:23307238-23307260 GCCTGGTCCCTGTCCACAAGGGG + Intronic
1164304063 19:23988082-23988104 GCCTGGTCCCTGTCCATAGGGGG - Intergenic
1164601877 19:29567851-29567873 GGAAGTTCTCTGTCCCCAGGAGG - Intergenic
1165372155 19:35415344-35415366 GGCTGGTCCCTCTCTTCTGGGGG + Intergenic
1166252107 19:41578215-41578237 GGAAGTGCACTGTCCTCAGGAGG + Intronic
1166290360 19:41859830-41859852 GGCTGTTCCCTGGCCGGAAGTGG - Intergenic
1166955894 19:46464628-46464650 GACTGTTCCCTCTGCCCAGGAGG + Intergenic
1168095042 19:54109766-54109788 TGCTGTTCCCTCCCTTCAGGGGG + Intronic
925062639 2:905085-905107 GCCTGTTCCCTGTGCTCCTGGGG - Intergenic
925344068 2:3157574-3157596 GTCTGTTGCCTGTCTACAGGAGG + Intergenic
931287428 2:60844462-60844484 AGCTCTTCCCTGTCCTCACCGGG + Intergenic
933754068 2:85623854-85623876 GATTCTTCCCTGTCCTCAGGTGG - Intronic
934109532 2:88729256-88729278 TGCTCTTCCCTGTCCTCCGCAGG + Exonic
938058502 2:128234164-128234186 GGCAGTTCCCTTTGGTCAGGCGG + Intergenic
938302267 2:130225039-130225061 GCCTGTAGCCTGTACTCAGGAGG - Intergenic
938454413 2:131449229-131449251 GCCTGTAGCCTGTACTCAGGAGG + Intergenic
938930736 2:136084423-136084445 GGCTGTTCCTTGTCGTCATTTGG + Intergenic
940851531 2:158691720-158691742 GGCTGTGCCCTGTACTCTGGGGG - Intergenic
941681404 2:168403498-168403520 GGCTGTTGCCTTGCCTCTGGTGG + Intergenic
948460885 2:238129395-238129417 GGCTGTTCCCTCTGCCTAGGAGG - Intronic
948556220 2:238813306-238813328 TGATGTTTCCTGTCCTCAGAGGG - Intergenic
948653866 2:239464948-239464970 GGGTGTCTCCTGTCCACAGGAGG - Intergenic
948727893 2:239945935-239945957 GGCTGCTTCCTGTCCGCAAGCGG - Intronic
948844287 2:240675828-240675850 GGCTGTACCCCGTCCTCTGGTGG - Intergenic
948849571 2:240699051-240699073 GGCTGTACCCCGTCCTCTGGTGG + Intergenic
949065166 2:241985836-241985858 GGCGGTGCCCTGGCCTCACGTGG + Intergenic
1169868461 20:10225913-10225935 GGCTGAACTCTGGCCTCAGGGGG - Intronic
1170667537 20:18399779-18399801 AGCTGCTCCTTGGCCTCAGGTGG - Intronic
1172520375 20:35562008-35562030 GGCTGTGCCTTGTCCCCAAGTGG + Intergenic
1174447647 20:50601626-50601648 GGCTGTTCTCAGTTCACAGGAGG - Intronic
1174565374 20:51461017-51461039 AGGAGTTCCCCGTCCTCAGGTGG - Intronic
1175359830 20:58400328-58400350 AGCTGGTTCCTGTCCTCAAGGGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175966045 20:62660767-62660789 GCCTGTTCCGTGGCCTGAGGGGG - Intronic
1176373309 21:6075244-6075266 GGGTGTTCCCTTTGCTCTGGAGG - Intergenic
1176373794 21:6077445-6077467 GGCCCTGCCCTGTCCACAGGAGG + Intergenic
1178251348 21:31006357-31006379 TGCTGTTCCCTGTCCTCTCTAGG - Intergenic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1179749683 21:43460798-43460820 GGCCCTGCCCTGTCCACAGGAGG - Intergenic
1179750168 21:43462999-43463021 GGGTGTTCCCTTTGCTCTGGAGG + Intergenic
1179823608 21:43951660-43951682 GGCTGTGCCATCTCCTCTGGGGG + Intronic
1182451188 22:30422919-30422941 GGCTTTTCCCAGGTCTCAGGAGG + Exonic
1183433893 22:37782279-37782301 AGCTGGTCCCTGGCCTCAGGGGG - Intergenic
1184419918 22:44373815-44373837 GGCTGTCCCCAGTCCTCACTGGG - Intergenic
1184425553 22:44407145-44407167 GGCAGGGGCCTGTCCTCAGGAGG + Intergenic
1185198522 22:49488193-49488215 GGCAGTTCCCTGCCCTAAGCCGG - Intronic
1185271262 22:49930194-49930216 GGCGGTCCCCTGTCCCCTGGAGG - Intergenic
951907986 3:27722320-27722342 GGCTGCTTCCTCTCCTCCGGTGG + Intronic
952960801 3:38588008-38588030 TGCTGTTCCTGCTCCTCAGGAGG + Intronic
954380696 3:50217523-50217545 GGGAGTTCCCTGTCATCAGGAGG + Intronic
955713234 3:61801739-61801761 GGCTGTTCACTGTCCACAGCAGG + Intronic
960727224 3:120682642-120682664 TCCTGGTCCCTGTCTTCAGGTGG - Intergenic
961176030 3:124835634-124835656 GGCGGGTCCCTCTCTTCAGGTGG + Intronic
961539908 3:127592204-127592226 GGCAGTTTCCTGCCCTCTGGAGG - Intronic
961828840 3:129612920-129612942 GGCTGTTCCCTGTTCTCCAGGGG + Intergenic
962289684 3:134123598-134123620 GGCTATGCCCTGCCCTCAGGCGG - Intronic
968451017 4:676054-676076 GCCTGAACCCTGTCCTCAGGGGG + Intronic
969248550 4:5952491-5952513 GGCTGGTCTCTGGCCCCAGGCGG + Intronic
969472069 4:7394797-7394819 GGCTCTGCCCTGGCCTCGGGGGG - Intronic
969723826 4:8907683-8907705 GGCTGTTCCCTGGACACAAGGGG - Intergenic
972694596 4:41433471-41433493 GGCTGGTCCCTGTGTTCAGTTGG + Intronic
973770623 4:54203245-54203267 GGCTGATCTCTGTCCTCTGGAGG + Intronic
976322817 4:83734725-83734747 GGTTCTGCCCTGTTCTCAGGAGG + Intergenic
981485537 4:145282230-145282252 AGCTATCCCATGTCCTCAGGAGG - Intergenic
984103155 4:175511795-175511817 GTCAGTTTCCTGTGCTCAGGAGG - Intergenic
986263262 5:6167502-6167524 AGATGTTCCCTGACCTCAAGGGG - Intergenic
986732523 5:10645731-10645753 TGCTGGTCCCTTTCGTCAGGAGG + Intronic
987192810 5:15496834-15496856 TGTTGTTCCCTGACCTGAGGGGG + Intergenic
994245585 5:97471927-97471949 GGCTGTGCCCTGGCTCCAGGAGG + Intergenic
998565420 5:143212153-143212175 TGCTCTGCCCTGTCCTCAAGAGG + Intronic
1001517005 5:172362866-172362888 GTCTGTTTCCTATCCACAGGGGG - Exonic
1001949655 5:175807431-175807453 GCATCTTCCCTGTCCTTAGGTGG - Intronic
1002202630 5:177538824-177538846 GGCTGTTCCCTGTCCTCAGGTGG - Intronic
1004251463 6:14026369-14026391 GGCTGTTCCCTGGCAGCAGTGGG + Intergenic
1005971925 6:30768454-30768476 GCCTGATCCCTGCCCTCAAGAGG - Intergenic
1006188076 6:32191734-32191756 AGCTGTTCTCTGTCCTCGAGAGG + Exonic
1006339531 6:33439068-33439090 GCCTGGTCCCTGCCCTCAGAGGG + Intronic
1006629758 6:35422565-35422587 GGCTCTCCCCTGTCCTCTAGGGG - Intronic
1006647092 6:35522349-35522371 GGCTCTTCCCTCTGCTCTGGGGG - Intergenic
1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG + Intronic
1011837376 6:91450170-91450192 GGTTTTGCCCTATCCTCAGGAGG + Intergenic
1013468578 6:110440142-110440164 GGTGGTTCCCTGCTCTCAGGAGG + Intronic
1013685249 6:112573893-112573915 GGGTGTTGACTGACCTCAGGTGG - Intergenic
1014023561 6:116618173-116618195 GGCTGTTCCCTCTGCCCAGAAGG + Intronic
1017412720 6:154186458-154186480 GGCTGCTGCCTGTGTTCAGGTGG - Intronic
1018242649 6:161793574-161793596 GAATGTTCCATCTCCTCAGGAGG + Intronic
1018444486 6:163842619-163842641 AGCTGTTTCATGTTCTCAGGTGG - Intergenic
1018763246 6:166908722-166908744 GGCTTTTCCCAGTCCTCTGAAGG + Intronic
1019143925 6:169964775-169964797 GACTCTTCCAAGTCCTCAGGTGG - Intergenic
1019153742 6:170025508-170025530 GGCTGTTCCCTGTGACCAGAGGG - Intergenic
1019690283 7:2406608-2406630 GGCTTTTCCCTGTAGACAGGAGG + Intronic
1019712885 7:2525395-2525417 GGCCCTGCCTTGTCCTCAGGTGG + Exonic
1021976834 7:26019407-26019429 GACTGTTCCCTGCACTCAGCAGG - Intergenic
1022984199 7:35634558-35634580 GGTAGTTCCCTGTCCTGAAGTGG - Intronic
1024349645 7:48350624-48350646 ATCTGTTCACTTTCCTCAGGAGG + Exonic
1025738273 7:64174329-64174351 GGCTGTCCCCTTTCCTGAGCAGG + Intronic
1026891731 7:73986326-73986348 GCCTGATCCCTGGGCTCAGGTGG - Intergenic
1028874164 7:95801941-95801963 GGAAATGCCCTGTCCTCAGGAGG - Intronic
1029329036 7:99836075-99836097 GGACATTCCCTTTCCTCAGGTGG - Intronic
1032260088 7:130328630-130328652 GTCTGCTCCCTGCCTTCAGGGGG - Intergenic
1032443320 7:131959091-131959113 GGGTGTGCCCTGTCCTGAGGAGG - Intergenic
1032751931 7:134850205-134850227 AGCTGTTTCCTGTCAGCAGGAGG - Intronic
1035310242 7:157963169-157963191 GGCAGTCTCCTGGCCTCAGGTGG + Intronic
1035333770 7:158112926-158112948 AGGTGTTCACTGGCCTCAGGAGG + Intronic
1035765569 8:2102126-2102148 GGCTGTTTCCTGTCATCAAAGGG - Intronic
1036656513 8:10680744-10680766 AGCTGTTTGCTGTCCTCAGGAGG + Intronic
1036964031 8:13276482-13276504 GGCTGTCGCCTGCCTTCAGGAGG + Intronic
1037341286 8:17848270-17848292 GGCTGTTCAGTGTCTTCGGGAGG - Intergenic
1037954098 8:23040057-23040079 GGCTACTCCCTGTACTCAGGAGG + Intronic
1039897689 8:41727859-41727881 GGGTGTTGCCTTTCCACAGGTGG - Intronic
1039977506 8:42379987-42380009 GGCTGCTCCCTGGCCTCAAGTGG - Intergenic
1041311733 8:56524333-56524355 GCCAGATCTCTGTCCTCAGGAGG - Intergenic
1041437232 8:57855620-57855642 GGGTGATCCCACTCCTCAGGGGG + Intergenic
1042733038 8:71957954-71957976 AGCTGTTCCCTTTTCTCCGGAGG + Intronic
1043236510 8:77875057-77875079 AGTTGTTCCCTGGCCTAAGGTGG + Intergenic
1045109224 8:98924156-98924178 GGCTGTTCCCCGTCCTTGGCAGG + Intronic
1045388052 8:101689980-101690002 TGCTCTTCCCTGACCTCAGATGG - Intronic
1049402339 8:142434034-142434056 GGCTGTTCTGTGCCTTCAGGTGG + Intergenic
1050267880 9:3910018-3910040 GGATGTTCCCTGTCATCAAAAGG - Intronic
1053156940 9:35787839-35787861 GGCTGTTCTCTGCCCTCTGTTGG + Intergenic
1057262792 9:93594783-93594805 GGCTGGTCTGTGTCCTCAGCCGG - Intronic
1057867562 9:98693354-98693376 GGCCCCTCCATGTCCTCAGGTGG + Intronic
1059325895 9:113503817-113503839 GCGTCTTCCCTGGCCTCAGGCGG + Intronic
1061263208 9:129491252-129491274 GTCTGTTCCCTCTCTTCAGAGGG + Intergenic
1061718283 9:132534965-132534987 GGCTGATCTCTGTGCCCAGGAGG - Intronic
1061897706 9:133657048-133657070 GGCTGTTCCTTGTCCCCACCAGG + Exonic
1062143426 9:134973129-134973151 GATTCTTCCCTGGCCTCAGGTGG - Intergenic
1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG + Intronic
1191037791 X:56045914-56045936 GTCTCTTCCCAGTTCTCAGGGGG + Intergenic
1191608371 X:63085523-63085545 GGCTGTTCATTTGCCTCAGGAGG + Intergenic
1193750885 X:85342061-85342083 AGCTGTTCCCTGTCATCAACAGG + Intronic
1193995617 X:88363672-88363694 GGCTGTTCCCTGCCTGCTGGGGG - Intergenic
1197639036 X:128947691-128947713 GGCTGTTCCATGTCCTTTGCAGG - Intergenic
1197703124 X:129614896-129614918 GACTGTCCCCTGTCCCCAGGAGG - Intergenic
1199248341 X:145631903-145631925 CGCTGGGCCCTGTCCTCAGGCGG - Intergenic
1200079739 X:153570300-153570322 CGCTGTCACCTGTCCCCAGGTGG + Intronic
1200248007 X:154536042-154536064 AGCTGTGCCCTGCCCTCAGGTGG - Exonic
1200865113 Y:8035132-8035154 GCCTTTTCCCTGTTCTCAGGTGG + Intergenic
1201277625 Y:12313608-12313630 GGAAATTCCCTTTCCTCAGGTGG - Intergenic