ID: 1002202630

View in Genome Browser
Species Human (GRCh38)
Location 5:177538824-177538846
Sequence GGCTGTTCCCTGTCCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002202630_1002202639 13 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202639 5:177538860-177538882 GAGGAGCCCTCCTGCATTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 143
1002202630_1002202633 -10 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202633 5:177538837-177538859 GGGAACAGCCTGACTTCCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1002202630_1002202634 -9 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202634 5:177538838-177538860 GGAACAGCCTGACTTCCTTGGGG 0: 1
1: 0
2: 1
3: 10
4: 188
1002202630_1002202638 12 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202638 5:177538859-177538881 GGAGGAGCCCTCCTGCATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1002202630_1002202635 -6 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202635 5:177538841-177538863 ACAGCCTGACTTCCTTGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 193
1002202630_1002202643 27 Left 1002202630 5:177538824-177538846 CCACCTGAGGACAGGGAACAGCC 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1002202643 5:177538874-177538896 CATTCAGGGACCCCTGTCAGCGG 0: 1
1: 0
2: 3
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002202630 Original CRISPR GGCTGTTCCCTGTCCTCAGG TGG (reversed) Intronic