ID: 1002205273

View in Genome Browser
Species Human (GRCh38)
Location 5:177558664-177558686
Sequence TGTACCTCCAACACTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002205267_1002205273 9 Left 1002205267 5:177558632-177558654 CCCAGTACAGGCTGGGCGCAGTG No data
Right 1002205273 5:177558664-177558686 TGTACCTCCAACACTGTGGGAGG No data
1002205268_1002205273 8 Left 1002205268 5:177558633-177558655 CCAGTACAGGCTGGGCGCAGTGG No data
Right 1002205273 5:177558664-177558686 TGTACCTCCAACACTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002205273 Original CRISPR TGTACCTCCAACACTGTGGG AGG Intergenic
No off target data available for this crispr