ID: 1002206058

View in Genome Browser
Species Human (GRCh38)
Location 5:177563422-177563444
Sequence ACCTCTCCATGAATGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002206058_1002206061 -7 Left 1002206058 5:177563422-177563444 CCCACAGGCATTCATGGAGAGGT No data
Right 1002206061 5:177563438-177563460 GAGAGGTCATTGGTCCCCACTGG No data
1002206058_1002206062 -3 Left 1002206058 5:177563422-177563444 CCCACAGGCATTCATGGAGAGGT No data
Right 1002206062 5:177563442-177563464 GGTCATTGGTCCCCACTGGTTGG No data
1002206058_1002206066 10 Left 1002206058 5:177563422-177563444 CCCACAGGCATTCATGGAGAGGT No data
Right 1002206066 5:177563455-177563477 CACTGGTTGGTGCTGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002206058 Original CRISPR ACCTCTCCATGAATGCCTGT GGG (reversed) Intergenic