ID: 1002206890

View in Genome Browser
Species Human (GRCh38)
Location 5:177569146-177569168
Sequence CCTGAGTTGCAGACAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002206890_1002206894 -8 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206894 5:177569161-177569183 AACTCAGGTGCCCGGCCAGTTGG No data
1002206890_1002206900 8 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206900 5:177569177-177569199 CAGTTGGGTGAGGATTTTGCAGG No data
1002206890_1002206895 -7 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206895 5:177569162-177569184 ACTCAGGTGCCCGGCCAGTTGGG No data
1002206890_1002206901 20 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206901 5:177569189-177569211 GATTTTGCAGGATAGAACCCTGG No data
1002206890_1002206902 29 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206902 5:177569198-177569220 GGATAGAACCCTGGAAAGCTTGG No data
1002206890_1002206896 -2 Left 1002206890 5:177569146-177569168 CCCTGCACTGTCTGCAACTCAGG No data
Right 1002206896 5:177569167-177569189 GGTGCCCGGCCAGTTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002206890 Original CRISPR CCTGAGTTGCAGACAGTGCA GGG (reversed) Intergenic
No off target data available for this crispr