ID: 1002208075

View in Genome Browser
Species Human (GRCh38)
Location 5:177577984-177578006
Sequence GAGGAGTGATGGAGATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002208075_1002208080 24 Left 1002208075 5:177577984-177578006 CCTCATAATCTCCATCACTCCTC No data
Right 1002208080 5:177578031-177578053 TCTCATGTTTATGTTAAATGTGG No data
1002208075_1002208078 -8 Left 1002208075 5:177577984-177578006 CCTCATAATCTCCATCACTCCTC No data
Right 1002208078 5:177577999-177578021 CACTCCTCTTAGGATATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002208075 Original CRISPR GAGGAGTGATGGAGATTATG AGG (reversed) Intergenic
No off target data available for this crispr