ID: 1002208144

View in Genome Browser
Species Human (GRCh38)
Location 5:177578515-177578537
Sequence CAAGTTGGACAACTAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002208144_1002208150 27 Left 1002208144 5:177578515-177578537 CCTACTTCTAGTTGTCCAACTTG No data
Right 1002208150 5:177578565-177578587 GTTTGATCTAACCTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002208144 Original CRISPR CAAGTTGGACAACTAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr