ID: 1002210849

View in Genome Browser
Species Human (GRCh38)
Location 5:177598556-177598578
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002210843_1002210849 2 Left 1002210843 5:177598531-177598553 CCTGATATAGTAACAGCTAACCG No data
Right 1002210849 5:177598556-177598578 TGGAGTGGTCCCCTTTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002210849 Original CRISPR TGGAGTGGTCCCCTTTAGAT GGG Intergenic
No off target data available for this crispr