ID: 1002211919

View in Genome Browser
Species Human (GRCh38)
Location 5:177604425-177604447
Sequence GCCCTTCCGCGAACGCTTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002211912_1002211919 1 Left 1002211912 5:177604401-177604423 CCCCCACCGCCTGGCAGTGCTGG 0: 1
1: 0
2: 2
3: 36
4: 488
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211911_1002211919 8 Left 1002211911 5:177604394-177604416 CCTGGGGCCCCCACCGCCTGGCA 0: 1
1: 0
2: 0
3: 38
4: 486
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211916_1002211919 -2 Left 1002211916 5:177604404-177604426 CCACCGCCTGGCAGTGCTGGTGC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211917_1002211919 -5 Left 1002211917 5:177604407-177604429 CCGCCTGGCAGTGCTGGTGCCCT 0: 1
1: 0
2: 2
3: 25
4: 277
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211918_1002211919 -8 Left 1002211918 5:177604410-177604432 CCTGGCAGTGCTGGTGCCCTTCC 0: 1
1: 1
2: 2
3: 25
4: 298
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211914_1002211919 0 Left 1002211914 5:177604402-177604424 CCCCACCGCCTGGCAGTGCTGGT 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1002211915_1002211919 -1 Left 1002211915 5:177604403-177604425 CCCACCGCCTGGCAGTGCTGGTG 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002211919 Original CRISPR GCCCTTCCGCGAACGCTTCG AGG Exonic
921010136 1:211133487-211133509 ACCCTTCCGCGAAGGCTCTGGGG - Intronic
1074433933 10:113417746-113417768 GCCCTTCCTCCATCGCTTCTGGG - Intergenic
1083289091 11:61680132-61680154 TCCCTTCCCCGCACGCATCGCGG + Intergenic
1097167744 12:57094604-57094626 GCCCTTCCTCGAACTCTGCAGGG - Exonic
1104987097 12:132603447-132603469 CTCCTTCCGCGGCCGCTTCGAGG - Intronic
1114629773 14:24151601-24151623 GCCCTTCCGCCAGCGCCTCTGGG + Exonic
1148577812 17:48723656-48723678 GCGCTTCCGGGAACCCTGCGAGG - Intronic
1159928857 18:74292195-74292217 GCCCTTCCGCGCAGACTCCGTGG - Intergenic
1162529414 19:11227396-11227418 GCGCTTCCCCGGACGCTTCCTGG - Exonic
925168082 2:1731480-1731502 CCCCTTCCGTGACAGCTTCGAGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
954540680 3:51391455-51391477 GCGCTCCCGCGGACGCTTGGCGG - Exonic
1002211919 5:177604425-177604447 GCCCTTCCGCGAACGCTTCGAGG + Exonic
1002526678 5:179819238-179819260 GCCCTTCCCCGCACGCCTTGCGG - Intronic
1023262665 7:38373442-38373464 TCCCTTCCGCACACTCTTCGTGG - Intergenic