ID: 1002214805

View in Genome Browser
Species Human (GRCh38)
Location 5:177623331-177623353
Sequence AAAGACTTGCTGAAAGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002214805_1002214807 5 Left 1002214805 5:177623331-177623353 CCTTTTACTTTCAGCAAGTCTTT No data
Right 1002214807 5:177623359-177623381 TTTTTTTTTTTTTAGAGACAGGG 0: 693
1: 19289
2: 31780
3: 71445
4: 286608
1002214805_1002214808 27 Left 1002214805 5:177623331-177623353 CCTTTTACTTTCAGCAAGTCTTT No data
Right 1002214808 5:177623381-177623403 GTCTTGCTCTGTCACCCAACTGG No data
1002214805_1002214806 4 Left 1002214805 5:177623331-177623353 CCTTTTACTTTCAGCAAGTCTTT No data
Right 1002214806 5:177623358-177623380 CTTTTTTTTTTTTTAGAGACAGG 0: 39
1: 2145
2: 23367
3: 40903
4: 88537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002214805 Original CRISPR AAAGACTTGCTGAAAGTAAA AGG (reversed) Intergenic
No off target data available for this crispr