ID: 1002216502

View in Genome Browser
Species Human (GRCh38)
Location 5:177638768-177638790
Sequence CTCCAACAGAACTGCAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002216502_1002216510 29 Left 1002216502 5:177638768-177638790 CCTTAGCTGCAGTTCTGTTGGAG No data
Right 1002216510 5:177638820-177638842 TGCCTGGGTATCACCAGTGGAGG 0: 466
1: 1343
2: 2211
3: 1972
4: 953
1002216502_1002216507 14 Left 1002216502 5:177638768-177638790 CCTTAGCTGCAGTTCTGTTGGAG No data
Right 1002216507 5:177638805-177638827 ACTCCAGACACTGTTTGCCTGGG 0: 86
1: 3160
2: 2298
3: 987
4: 602
1002216502_1002216509 26 Left 1002216502 5:177638768-177638790 CCTTAGCTGCAGTTCTGTTGGAG No data
Right 1002216509 5:177638817-177638839 GTTTGCCTGGGTATCACCAGTGG 0: 902
1: 2121
2: 1266
3: 497
4: 234
1002216502_1002216506 13 Left 1002216502 5:177638768-177638790 CCTTAGCTGCAGTTCTGTTGGAG No data
Right 1002216506 5:177638804-177638826 CACTCCAGACACTGTTTGCCTGG 0: 82
1: 3179
2: 2305
3: 1042
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002216502 Original CRISPR CTCCAACAGAACTGCAGCTA AGG (reversed) Intergenic
No off target data available for this crispr