ID: 1002221307

View in Genome Browser
Species Human (GRCh38)
Location 5:177684759-177684781
Sequence CTTTAAGTGTAGGTTGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002221299_1002221307 10 Left 1002221299 5:177684726-177684748 CCCTCCTTCAAAAGGCAGGTCTA No data
Right 1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG No data
1002221295_1002221307 29 Left 1002221295 5:177684707-177684729 CCACAAATTCCTTAGAAGTCCCT No data
Right 1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG No data
1002221296_1002221307 20 Left 1002221296 5:177684716-177684738 CCTTAGAAGTCCCTCCTTCAAAA No data
Right 1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG No data
1002221300_1002221307 9 Left 1002221300 5:177684727-177684749 CCTCCTTCAAAAGGCAGGTCTAA No data
Right 1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG No data
1002221301_1002221307 6 Left 1002221301 5:177684730-177684752 CCTTCAAAAGGCAGGTCTAATTT No data
Right 1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002221307 Original CRISPR CTTTAAGTGTAGGTTGTACT TGG Intergenic
No off target data available for this crispr