ID: 1002227454

View in Genome Browser
Species Human (GRCh38)
Location 5:177734135-177734157
Sequence ACATGAGCAGGCCCCTTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 0, 2: 3, 3: 18, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002227452_1002227454 -4 Left 1002227452 5:177734116-177734138 CCACATGAATTCACAAAAGACAT 0: 5
1: 0
2: 1
3: 23
4: 282
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175
1002227447_1002227454 20 Left 1002227447 5:177734092-177734114 CCCCCAGACTCACTGACCACAGC 0: 1
1: 1
2: 2
3: 31
4: 272
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175
1002227449_1002227454 18 Left 1002227449 5:177734094-177734116 CCCAGACTCACTGACCACAGCAC 0: 1
1: 1
2: 0
3: 21
4: 220
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175
1002227450_1002227454 17 Left 1002227450 5:177734095-177734117 CCAGACTCACTGACCACAGCACC 0: 1
1: 1
2: 0
3: 28
4: 227
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175
1002227448_1002227454 19 Left 1002227448 5:177734093-177734115 CCCCAGACTCACTGACCACAGCA 0: 1
1: 1
2: 4
3: 25
4: 277
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175
1002227451_1002227454 4 Left 1002227451 5:177734108-177734130 CCACAGCACCACATGAATTCACA 0: 1
1: 1
2: 4
3: 36
4: 276
Right 1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG 0: 2
1: 0
2: 3
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002227454 Original CRISPR ACATGAGCAGGCCCCTTGCA CGG Intronic
901072195 1:6526651-6526673 ACCTGAGTAGGCTCCTTCCAGGG + Intronic
901726667 1:11248258-11248280 ACAAAATCAGGTCCCTTGCAAGG - Intronic
901878183 1:12179005-12179027 ACATCAGCAGGCCCCTTGGAGGG + Intronic
902161787 1:14536303-14536325 ACATGAGCAGCTGTCTTGCACGG - Intergenic
903161338 1:21491254-21491276 ACAGGAGCAGGCTCCGTGCAAGG - Intergenic
904581008 1:31544359-31544381 ATATGAGTATCCCCCTTGCAGGG + Intergenic
905519155 1:38584714-38584736 ACAAGAGCAGGTCACTTCCAGGG + Intergenic
907317932 1:53584396-53584418 CCATGAGAAGACCCATTGCAGGG - Intronic
907374538 1:54024995-54025017 ACAAGATCATGCCCTTTGCAGGG - Intergenic
910096654 1:83530376-83530398 ACAAGATCATGCCCTTTGCAGGG + Intergenic
911100676 1:94093576-94093598 ACAAGAGCAGGCCCCTGGGAAGG - Intronic
911445793 1:97990264-97990286 ACATGATCATGTCCTTTGCAGGG + Intergenic
915691404 1:157694815-157694837 ACAGCAGCAGGCCTCTTTCATGG - Intronic
916292845 1:163185581-163185603 CCATGAAAGGGCCCCTTGCAAGG - Intronic
918083809 1:181228265-181228287 ACTTGCCCAGGCCCCTTTCAGGG + Intergenic
920637011 1:207713665-207713687 ACAGGAGCGGGCTCCGTGCAAGG + Intronic
1063172984 10:3526376-3526398 ACAAGAGCAGCCCTGTTGCAAGG + Intergenic
1063367122 10:5498423-5498445 ACAGGAGCGGGCGCCTCGCATGG - Intergenic
1065999043 10:31087313-31087335 ACCTGAGCAGCCCATTTGCAAGG - Intergenic
1066201975 10:33150703-33150725 ACATGACCAGATCCCTTGGAGGG - Intergenic
1067678300 10:48406483-48406505 ACATGATTAGGCCTCTAGCAGGG + Intronic
1068386092 10:56329699-56329721 ACATGACCATGCCACTTCCATGG - Intergenic
1069215007 10:65808987-65809009 ACATGAGCATGCCCACAGCAGGG - Intergenic
1070654800 10:78263989-78264011 GCATGAACAGGCCCGTGGCAGGG + Intergenic
1071141099 10:82510357-82510379 ATAAGCGCAGGCCCCTTCCATGG + Intronic
1071213001 10:83366183-83366205 ACATGAACAGGGTCCTTGGAGGG + Intergenic
1071455122 10:85842154-85842176 ACAAGATCATGTCCCTTGCAAGG + Intronic
1074582930 10:114737527-114737549 ACATGAGCAGGCCCATTTACAGG - Intergenic
1074588890 10:114793678-114793700 ACAGGAGCAGGCCCATTACTGGG + Intergenic
1076133799 10:128030891-128030913 ACAGGGGCAGGCACCCTGCAGGG + Intronic
1076653449 10:132005608-132005630 ACATGAGGAGCCCCCTCCCAGGG - Intergenic
1077200015 11:1302074-1302096 CCTGGAGCAGGCCCCTTGCAGGG - Intronic
1077412592 11:2410566-2410588 ACCTGTGCAGGCCCCTGGGATGG - Intronic
1077872415 11:6273099-6273121 ACTTGCACAGGCCCCTTTCAAGG - Intergenic
1078072573 11:8126671-8126693 AGCTGAGGAGGCCCCTTACATGG - Exonic
1080643732 11:34173544-34173566 GAAAGAGCAGGTCCCTTGCAAGG - Intronic
1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG + Intergenic
1083096318 11:60254828-60254850 ACAGGAGCAGGCTTCATGCAGGG - Intergenic
1084747343 11:71181639-71181661 CCATGAGCGGGCGCCTTGCTTGG - Intronic
1085340554 11:75728591-75728613 CCTTGGGCAGGTCCCTTGCAGGG - Intronic
1085972085 11:81605302-81605324 ACATGCCCAGGCCCCTTCCAGGG - Intergenic
1089814612 11:121161298-121161320 ACATGAGGAGGCCCCATATATGG + Intronic
1090174467 11:124636206-124636228 ACATGTGCAGGCACTTTGGAAGG - Exonic
1090480133 11:127060812-127060834 ACAAGTGCAGTCTCCTTGCACGG + Intergenic
1090771979 11:129928809-129928831 ACATGAGCCTGGCCCTAGCAGGG - Intronic
1093346931 12:18049442-18049464 ATATGAGCAGGTTCATTGCAGGG + Intergenic
1094269648 12:28599108-28599130 ACTTGTCCAGGCCCCTTCCAAGG + Intergenic
1096075474 12:48801161-48801183 ACAACAGCAGGAGCCTTGCAGGG + Intergenic
1097773675 12:63620888-63620910 ACAAGATCAGGTCCTTTGCAGGG + Intronic
1098107725 12:67087952-67087974 ACATGAGAATGCCCATTGCAAGG + Intergenic
1101409030 12:104454103-104454125 AAATGGGCAGGCCCCTGGCCGGG + Intergenic
1103189423 12:118988402-118988424 ATATGAGCAGCTCCCTTCCACGG - Intronic
1105278698 13:18950842-18950864 AACTGAGCAGGACCCTAGCATGG + Intergenic
1105704290 13:22960034-22960056 ACATGAGCAGTTGCCTGGCAGGG + Intergenic
1105857241 13:24385086-24385108 ACATGAGCAGTCGCCTGGCAGGG + Intergenic
1106501535 13:30333810-30333832 ACCAGAGCAGGCCCCTCCCAAGG - Intergenic
1106924534 13:34600287-34600309 GCAGGAGCAGGCATCTTGCATGG - Intergenic
1107208052 13:37819500-37819522 ACAAGATCATGTCCCTTGCAGGG + Intronic
1113040342 13:106098334-106098356 GAATGAGCAGGCCCCCTGAAAGG + Intergenic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1117105876 14:52396310-52396332 ACATGTGCAGGCTCGTTACAAGG + Intergenic
1117590427 14:57262784-57262806 AAATTAGAAGGACCCTTGCAGGG - Intronic
1119207181 14:72803118-72803140 ACTGAAGCAGGCCCCTTCCAAGG + Intronic
1120483156 14:85077663-85077685 ACAAGATCATGCCCTTTGCAGGG - Intergenic
1121838617 14:97114598-97114620 CCATGAGCAGGCACTGTGCAAGG - Intergenic
1122815365 14:104309530-104309552 ACATGAGCAGCCCCCTTGCCCGG + Intergenic
1123025661 14:105422485-105422507 ACAGGAGCAAGCCCCTTCCCAGG - Intronic
1123990922 15:25682652-25682674 ACAGAAGCAGGCCGCATGCACGG - Intronic
1124911698 15:33927596-33927618 ACTTGCACAGGCCCCTTCCAAGG + Intronic
1125200493 15:37097802-37097824 AGAAGAGCAGGCCCCCTCCACGG + Intronic
1127900951 15:63340531-63340553 ACATGAACTAGCCCCTTTCAGGG + Intronic
1129952655 15:79605720-79605742 ACAACAGCAGGCCCGTGGCAGGG - Intergenic
1130327956 15:82896539-82896561 ACATGGTCAGGCCCTCTGCAGGG + Intronic
1134059919 16:11193006-11193028 CCATGAGCAGCCCCAGTGCAGGG + Intergenic
1136554475 16:30999714-30999736 TCCTGAGCAGGCCCCCGGCATGG - Intronic
1138061370 16:53894257-53894279 CCATGGGCAGGCTCCTGGCAAGG - Intronic
1140271670 16:73471904-73471926 ACAGGAGCAAGCCCGCTGCATGG + Intergenic
1143110511 17:4550240-4550262 AGATGAGAAGGCCACTAGCACGG + Exonic
1144464492 17:15486122-15486144 ACATCTGCATGCCCCTTGCAGGG - Intronic
1146108820 17:30068588-30068610 ACATGGGCAGGTCCCTTGTGGGG + Intronic
1152582606 17:81173225-81173247 TCATGAGCCGGGCCCTGGCATGG + Intergenic
1152814131 17:82397534-82397556 ACCTGAGGAGGCCCCTAACAGGG + Intronic
1153617163 18:6945777-6945799 CCAGGAGCAGCCCCCATGCAGGG + Intronic
1154501825 18:15001186-15001208 ACCTGGCCAGGCCCCTTGCAGGG + Intergenic
1156033727 18:32743094-32743116 AAATCAGCAGGCCCTTTGTAGGG - Intronic
1156340568 18:36206578-36206600 ACATGTGCAGGCCTGTTACATGG + Intronic
1156731856 18:40203932-40203954 AAATGAGCAAGCCCCATGCTAGG - Intergenic
1163179168 19:15586621-15586643 ACAAGACCAGGTCCTTTGCAGGG - Intergenic
1163201523 19:15772984-15773006 GCATGAGCAGGCAACTAGCAAGG + Intergenic
1163225276 19:15956358-15956380 CAATGACCAGGCACCTTGCAGGG - Intergenic
1164670488 19:30069575-30069597 CCATGAGCAGGCCTGGTGCAGGG - Intergenic
1164844670 19:31421950-31421972 ACATGTGCAGTCACCTTGCCCGG + Intergenic
928358254 2:30640445-30640467 ATATGAGTAGGCACATTGCAGGG - Exonic
928860770 2:35854982-35855004 ACAAGAACATGTCCCTTGCAGGG + Intergenic
934732463 2:96668210-96668232 ATTTGAATAGGCCCCTTGCAAGG - Intergenic
937332402 2:121039796-121039818 ACCTGGGCAGGTCCCATGCATGG + Intergenic
938501006 2:131831355-131831377 ACCTGGCCAGGCCCCTTGCAGGG + Intergenic
941928345 2:170917371-170917393 ACAGGAGCGGGCTCCGTGCAGGG + Intergenic
942639722 2:178048652-178048674 AAAGGGACAGGCCCCTTGCATGG + Intronic
943483272 2:188448885-188448907 ACAGGAGCAGGCATGTTGCATGG - Intronic
946907479 2:224430487-224430509 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
947053640 2:226075532-226075554 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
1169244994 20:4018145-4018167 AAATGAGCAGGGACCTTGGAGGG - Intergenic
1170243951 20:14200207-14200229 ACATGATCATGTCCTTTGCAGGG + Intronic
1172290580 20:33773325-33773347 CCCTGTGCAGTCCCCTTGCAGGG + Intronic
1173478646 20:43382104-43382126 ACATGAGCAATTACCTTGCAAGG - Intergenic
1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG + Intronic
1176722811 21:10405559-10405581 GCATTAGCAGCGCCCTTGCACGG + Intergenic
1178834317 21:36083661-36083683 ACACAAACAGGCCCCTGGCAGGG + Intergenic
1179029884 21:37711378-37711400 CCACGAGCAGGCCTCTTCCAGGG - Intronic
1179363588 21:40735294-40735316 ACATGAGCAGGCAAGTAGCAAGG + Intronic
1179599766 21:42469143-42469165 ACAGGCACAGGCCCCTTGCAAGG + Intergenic
1179999649 21:44989538-44989560 ACAGGAGCAGGCCCCATGGTAGG - Intergenic
1180956937 22:19745463-19745485 ACCTGAGCAGGCGCCTGGCTGGG - Intergenic
1182859798 22:33549186-33549208 ACATGGGCAAGCCCAGTGCATGG + Intronic
1184784248 22:46664177-46664199 ACATGATCAGGCACCTTCCCAGG + Intronic
1184853211 22:47132573-47132595 ACATGAGCTGCCTCCTTGCCTGG + Intronic
953887162 3:46721215-46721237 ACATGATCATGTCCTTTGCAGGG + Intronic
954427807 3:50452685-50452707 ACATGAGAAGCCCCCTTGGCAGG + Intronic
954853402 3:53622451-53622473 ACAAGATCATGCCCTTTGCAGGG + Intronic
956148811 3:66220066-66220088 ACCTGAGCAGGCTCCTTGCCTGG - Intronic
959507612 3:107173299-107173321 ACAAGAGCATGTCCTTTGCAGGG + Intergenic
962211795 3:133485903-133485925 ACAAGATCAGGCCCCTGGCCGGG + Intergenic
962241769 3:133756244-133756266 ACATCAGCAGGGCTCCTGCAGGG - Intronic
964458569 3:156896038-156896060 ACAAGAGCATGTCCTTTGCAGGG + Intronic
966651364 3:182304503-182304525 ACACCAGCAGGCACCATGCATGG - Intergenic
967255519 3:187587923-187587945 ACAAGATCATGCCCTTTGCAGGG - Intergenic
971791359 4:31173795-31173817 ACAAGAGCATGCCCTTTGCAGGG - Intergenic
973922896 4:55707526-55707548 ATTTGCACAGGCCCCTTGCAAGG + Intergenic
974339589 4:60598210-60598232 ACAAGACCATGTCCCTTGCAGGG - Intergenic
980480878 4:133385504-133385526 ACAGGTGCCGGCTCCTTGCAAGG - Intergenic
980626741 4:135382353-135382375 GCATGAGTAGGCTCCATGCAGGG - Intergenic
981637273 4:146895136-146895158 ACAAGATCATGTCCCTTGCAGGG - Intronic
986125650 5:4880541-4880563 ACCTCAGCCGGCCCCTTGCGGGG - Intergenic
991649617 5:68838608-68838630 ACAAAAGCAGGCTCCTGGCAGGG + Intergenic
993761693 5:91803228-91803250 ACAGGAGCAGGCTCTGTGCAGGG - Intergenic
996506089 5:124268975-124268997 ACAAGATCATGCCCTTTGCAGGG - Intergenic
997347368 5:133201842-133201864 AAATGAGCAGGTCCCATGCTGGG + Intronic
997581763 5:135022009-135022031 ACAATAGCTGACCCCTTGCATGG - Intergenic
998150239 5:139752961-139752983 ACATGCACAGGCCCCTTTGAGGG + Intergenic
998214004 5:140223724-140223746 TCATGAGCAGGCCCCTCCCAGGG - Intronic
998925694 5:147123227-147123249 ACAAGATCATGCCCTTTGCAGGG - Intergenic
1001002629 5:168022171-168022193 GCATGAGCAGGCACCGTGCCGGG + Intronic
1001144296 5:169170367-169170389 GGAAGAGCAGGCCCCTAGCAGGG - Intronic
1001989418 5:176104003-176104025 ACATGAGCAGGCCCCTTGCACGG - Intronic
1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG + Intronic
1002436513 5:179234958-179234980 ACATGAGCAGGTCCCTGGGAGGG - Intronic
1002839806 6:896078-896100 ACATCAGCACGTCCCTTGCCAGG - Intergenic
1003251214 6:4430584-4430606 ACCTGAGATGGCCCCTTGAATGG + Intergenic
1003745795 6:9000474-9000496 ACAGGATCATGCCCTTTGCAGGG - Intergenic
1005153156 6:22775655-22775677 ACATGTGGAGGTCTCTTGCATGG + Intergenic
1005296068 6:24428545-24428567 ACAAGATCATGCCCTTTGCAGGG - Exonic
1006813644 6:36836933-36836955 ACATGAGCAGGCCCCAGGTCAGG + Intronic
1006977028 6:38112403-38112425 TAATGAGCATGCTCCTTGCAAGG + Intronic
1008261886 6:49376889-49376911 ACAAGATCATGCCCTTTGCAGGG + Intergenic
1008796237 6:55306409-55306431 ACAAGAGCATGTCCTTTGCAGGG - Intergenic
1010947001 6:81986758-81986780 ACAAGATCATGCCCTTTGCAAGG - Intergenic
1013414616 6:109913439-109913461 ACAGGGGCAGGCCCCTGGCTGGG + Intergenic
1013656579 6:112253190-112253212 ACAACAGCATGCCCATTGCATGG - Intronic
1015484506 6:133753140-133753162 CCATGAACAGGCCCCTTTGAAGG - Intergenic
1017269238 6:152487360-152487382 ACAAGATCATGCCCTTTGCAGGG - Intronic
1017964621 6:159253417-159253439 ACATTATCGGGCCCCCTGCAGGG + Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1022933244 7:35144640-35144662 ACAAGATCAGGTCCTTTGCAGGG + Intergenic
1026465052 7:70646746-70646768 CCTTGAGCAGCCGCCTTGCATGG - Intronic
1026880031 7:73902086-73902108 ACATATGCAGGCCCCCTTCAAGG + Intergenic
1029160825 7:98550627-98550649 ACCTGAGTGGGCACCTTGCATGG + Intergenic
1029829171 7:103237406-103237428 ACAAGATCAGGTCCTTTGCAGGG + Intergenic
1030385526 7:108863593-108863615 ACAAGAACAGGCTCCATGCAGGG - Intergenic
1031012669 7:116539893-116539915 ACAGGAGAAGTCCCCTGGCAAGG + Intronic
1031035687 7:116785368-116785390 GCAGGAGCAGGCATCTTGCATGG + Intronic
1035682010 8:1495184-1495206 ACACGAGCAGGCAACTTGCCTGG - Intergenic
1038286079 8:26207398-26207420 ACAGGAGCAAGCTCCATGCAGGG - Intergenic
1038547188 8:28434827-28434849 ACAGGAGCAAGCTCCGTGCAGGG + Intronic
1039948104 8:42147248-42147270 ACATGGACAGGCTCCTTTCATGG + Intergenic
1041353848 8:56978723-56978745 ACATGATCAGGTCCTTTGCAGGG + Intronic
1043419857 8:80087361-80087383 ACAAGAGCATGTCCTTTGCAGGG + Intronic
1044216922 8:89623168-89623190 GCAGGAGCAGGCACATTGCACGG + Intergenic
1044222622 8:89686921-89686943 ACATGATCATGTCCTTTGCAGGG - Intergenic
1046292264 8:112178650-112178672 ACATGAGAAAGCCACTTGCAAGG - Intergenic
1047279753 8:123434814-123434836 ACATGAGCAGACCCATTGGGAGG + Intronic
1048191711 8:132295713-132295735 ACAAGATCATGCCCTTTGCAGGG + Intronic
1048547778 8:135403665-135403687 ACAGGAGCTGGCTCCATGCAAGG + Intergenic
1049792770 8:144479535-144479557 ACAGGAGGAGCCCCCTTGCTAGG - Intronic
1051568589 9:18528518-18528540 ACAAGATCATGCCCCTTGCAGGG - Intronic
1055298519 9:74858998-74859020 ACATGAACAAACCCCTAGCAAGG + Intronic
1055613852 9:78051145-78051167 ACCTGAGCAGATCCCTTGGAGGG - Intergenic
1058466741 9:105236467-105236489 TCATGAGCAGGCCCTTTGGGAGG + Intergenic
1062498665 9:136843164-136843186 ACCTGGCCAGGCCCCTTGCAGGG - Intronic
1188914199 X:35889933-35889955 ACATTAGCAGGCCCGTGCCATGG - Intergenic
1189676647 X:43467765-43467787 ACAGGAACAAGCCCCATGCAGGG + Intergenic
1193748826 X:85317899-85317921 ACAAGATCATGCCCTTTGCAGGG + Intronic
1195943059 X:110180861-110180883 ACCTGGGCAAGCCCCTTGGATGG - Intronic
1196308872 X:114137487-114137509 ACTTGCACAGGCCCCTTTCAAGG - Intergenic
1196779614 X:119371702-119371724 ACAAGAGCATGTCCTTTGCAGGG - Intergenic
1197585133 X:128337668-128337690 ACAGGAGCAGGCATCTTACACGG - Intergenic
1198560385 X:137843441-137843463 ACAAGATCATGCCCTTTGCAGGG - Intergenic
1199381984 X:147182020-147182042 ATATGAGCAGACCCCATGAAAGG - Intergenic