ID: 1002227996

View in Genome Browser
Species Human (GRCh38)
Location 5:177738699-177738721
Sequence CAGCTGTGGTGGAGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 2, 1: 8, 2: 8, 3: 29, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002227990_1002227996 16 Left 1002227990 5:177738660-177738682 CCAGCTGCGTACTGGGGATATTA 0: 2
1: 0
2: 0
3: 12
4: 80
Right 1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG 0: 2
1: 8
2: 8
3: 29
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002227996 Original CRISPR CAGCTGTGGTGGAGGATAAA TGG Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
902270201 1:15298740-15298762 CAACTGTGGTGGATTAAAAATGG - Intronic
902760232 1:18576042-18576064 CGGCTATGGTGGACGGTAAAAGG + Intergenic
903805616 1:26003597-26003619 CTGCTTTGGTGGAGAATGAAGGG + Intergenic
903986503 1:27233138-27233160 CAGCTGTGGTGGAGAGTTCAGGG + Intergenic
905240655 1:36578864-36578886 CAACTGTGGTGTGGGAGAAAAGG + Intergenic
905501187 1:38439018-38439040 AAGCAGTGAGGGAGGATAAAAGG - Intergenic
905785742 1:40755932-40755954 CAGCTGTAGTTGGGGATAACTGG + Intronic
910830441 1:91455785-91455807 CAGCAGTGGTGGAGAAAAGAGGG - Intergenic
912978960 1:114353423-114353445 CAGCTGTGGGGGAGGAGGGAGGG + Intergenic
913676086 1:121141905-121141927 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914027979 1:143929849-143929871 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914314315 1:146495511-146495533 CAGCTGAGGTGAAGGATATAGGG + Intergenic
914500033 1:148237870-148237892 CAGCTGAGGTGAAGGATATAGGG - Intergenic
914679992 1:149932305-149932327 CATCTGTAGCTGAGGATAAATGG - Exonic
914747465 1:150510775-150510797 AATCTGGGGTGGAGGAGAAAGGG - Intronic
914811951 1:151035461-151035483 GAGCTGTGGGGTAGGAAAAAGGG - Exonic
915049102 1:153049186-153049208 CAGCTGATGTGGAGCCTAAAGGG + Intergenic
915053447 1:153102799-153102821 CAGCTGATGTGGAGCCTAAAGGG + Intronic
915472650 1:156135167-156135189 CAGCTGGAGGGGAGGACAAAGGG - Exonic
915791750 1:158679621-158679643 CAGCTGGGGTGAAGGATCTAAGG - Intronic
917965796 1:180177756-180177778 CCGCTGGGGTGGAGGAAAAGAGG - Intronic
918697477 1:187561423-187561445 CAGCAGTGGTGGCTGGTAAATGG + Intergenic
919100786 1:193094860-193094882 CATCAGAGGTGGAGGAAAAATGG - Intergenic
919363025 1:196619239-196619261 CAGATGTGGAGGAAGGTAAAGGG - Intergenic
919671664 1:200344003-200344025 CAGCTGAGGTTGAGAATCAATGG - Intergenic
920550962 1:206860403-206860425 CAGCCTTGTTGGAGGATAAGAGG - Intergenic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921622110 1:217336707-217336729 AAACTGAGGTGGAGGAGAAACGG - Intergenic
922096567 1:222447920-222447942 CAGATGTGGTGGAAGGAAAAAGG - Intergenic
923006567 1:230054536-230054558 CAGCTGTGGTGGAGGAGGATAGG - Intergenic
923550123 1:234957211-234957233 CAGCTGTGGGGAAGAACAAAAGG - Intergenic
923777203 1:236990394-236990416 CAGCTGTGATGGGGGGAAAAGGG - Intergenic
1064094048 10:12409367-12409389 CGGCTGTGATAGAGGATAGAGGG + Intronic
1064290062 10:14025683-14025705 CAGCTGTGGGAGGGGAGAAATGG - Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1067062927 10:43087221-43087243 CAGCTGAGGAGGAGGAGAGATGG - Intronic
1067106581 10:43370860-43370882 CACCTGTGGGGGAGGCTAAGTGG + Intergenic
1067658681 10:48217246-48217268 CTGCTTTGGTGCTGGATAAATGG + Intronic
1068103311 10:52582613-52582635 CAATCGTGGTGGAGGATGAAAGG + Intergenic
1068173114 10:53421937-53421959 CTGCTCTGGTGGAGGTAAAAGGG + Intergenic
1069875428 10:71560086-71560108 GAGCAGTGATGGAGGAGAAATGG - Intronic
1070573987 10:77663321-77663343 CAGCTGTGGAGGAGGGGAGAAGG - Intergenic
1070931462 10:80264011-80264033 CAGCTGAGGTGGGGTATAAAGGG + Intergenic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072223792 10:93349383-93349405 CAGCTGTGGGGGAAGGTATATGG - Intronic
1072742155 10:97915870-97915892 CAGCTTTGGTGGAGGAACAGAGG - Intronic
1073248252 10:102106663-102106685 CAGCTGGAGTGGAGGAAATACGG + Intergenic
1075025529 10:118980524-118980546 CTGCTGTGGTTGAGGATGAGTGG - Intergenic
1075156126 10:119977379-119977401 CAGCAGTCGGGGAGGATACAGGG - Intergenic
1075864511 10:125706057-125706079 AAGGTGTGGTGGAGGTTACAAGG - Intergenic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1077082376 11:729791-729813 CAGCTGTGGGGGAGGACAGAAGG - Intergenic
1077806610 11:5596600-5596622 CGCCTGGGGTGGGGGATAAACGG - Intronic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1080176169 11:29365404-29365426 GAGCTGAGATGGAGGATAATGGG - Intergenic
1081014894 11:37864902-37864924 GAGGTGGGGTGGAGGATATAGGG - Intergenic
1084460222 11:69292990-69293012 CAGCTGTAGTGGAGGGGAATTGG - Intergenic
1086258418 11:84908099-84908121 TTGCTGTTGTGGAGGCTAAAGGG - Intronic
1087934098 11:104012468-104012490 TAGCTTTGGGGGAGAATAAAAGG - Intronic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1090450375 11:126800843-126800865 TAGCTGTGATGGGGGATAATGGG + Intronic
1092697245 12:11186555-11186577 TGGCTGAGGTGGAGGATGAACGG - Exonic
1093459814 12:19397808-19397830 GAGCTGTGCTGAAGGATAACAGG + Intergenic
1094143113 12:27200979-27201001 CAGCTGGGGTGGAACATAACTGG + Intergenic
1094301215 12:28967132-28967154 GAGTTGTGGAGGAGGATAATAGG - Intergenic
1094435908 12:30420395-30420417 CACCTGAGATGGAGGATGAAGGG - Intergenic
1094655383 12:32414563-32414585 CAGCTGGGGAGGAGGGGAAATGG - Intronic
1095389786 12:41692202-41692224 CAGTTGTGGTGGAAGGCAAAGGG - Intergenic
1096410655 12:51374833-51374855 CAGCTTTGGAGGAGGATAATCGG - Intronic
1098135616 12:67398635-67398657 CAGCTGTGGTACAGGAAAATGGG + Intergenic
1101294475 12:103406986-103407008 ATTCTTTGGTGGAGGATAAAGGG - Intronic
1102161138 12:110770050-110770072 CAGCAGTGGTAGAGATTAAAGGG - Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1106960341 13:34990479-34990501 CAGCTGTGGCTGTGGCTAAAAGG - Intronic
1107389715 13:39951447-39951469 CAGCTGTGGGGGAGGAGGGAGGG + Intergenic
1109266374 13:60205442-60205464 CAGCTGTGCTGGAAGAGAATAGG + Intergenic
1109947802 13:69461466-69461488 CAGTGGTGGTGGTGGATGAAAGG - Intergenic
1110044905 13:70814918-70814940 CAATTGTGGTGGAAGGTAAAGGG - Intergenic
1110162305 13:72393114-72393136 CAGCTGTGGTGGAGCAGAGATGG - Intergenic
1110287985 13:73772401-73772423 CAGCTGCAGTGGCAGATAAACGG + Intronic
1111267332 13:85834197-85834219 CAGCTGTGGTGGGGGAGGGAGGG + Intergenic
1111468982 13:88651713-88651735 CAGTTGTGGTGGAAGGCAAAGGG + Intergenic
1112199507 13:97261385-97261407 CAGTTGAGGAGGTGGATAAAAGG - Intronic
1112495950 13:99904993-99905015 CAGATGTGGGGGAGCAGAAAAGG - Intergenic
1115143245 14:30198037-30198059 CAGTTATGGTGGAAGACAAAAGG - Intergenic
1116134889 14:40909984-40910006 CAGCTGTGGTGCAGGATGCAGGG + Intergenic
1116337775 14:43679918-43679940 CATCTGTTGTGGGGGAAAAAGGG + Intergenic
1116941767 14:50797956-50797978 GAGCTGGGGTGGAGGAAAGAAGG + Intronic
1117585645 14:57200167-57200189 CATCAGTGGTGGAGGAGAAGGGG - Intergenic
1119634590 14:76263722-76263744 CAGTTGTTGTGAAGGTTAAATGG - Intergenic
1122907533 14:104808606-104808628 CAGCTGTTGTGGAGGATGGTGGG + Intergenic
1124244710 15:28058966-28058988 CAGCTCTGGTGCTGGATGAAGGG + Intronic
1124670881 15:31637794-31637816 CAGATGTGGTGGAAGAGAACTGG + Intronic
1125423848 15:39530581-39530603 CACTTGTGGTGGAGGGTGAAGGG + Intergenic
1125895628 15:43299490-43299512 CAGCTAGGGTGGATGAAAAATGG + Intronic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1131453438 15:92564886-92564908 CATTTGTGGTGGAAGGTAAAGGG + Intergenic
1132658847 16:1052734-1052756 CAGCTGTGGTGGAGGAGGGAGGG + Intergenic
1132712857 16:1277014-1277036 CTCCTGTGGCTGAGGATAAAGGG - Intergenic
1133453340 16:5921762-5921784 CAATTATGGTGGAAGATAAAGGG + Intergenic
1134816895 16:17213242-17213264 CAATTGTGGTGGAAGGTAAAGGG - Intronic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1136091074 16:27920465-27920487 CAGCCATGGTGGAGGACAGAAGG - Intronic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137669683 16:50271960-50271982 CAGCGGTGGTGGGGGAAACAGGG - Intronic
1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG + Intergenic
1138475091 16:57265923-57265945 AAGCTGAGGTGGAGGATCAATGG + Intronic
1138791801 16:59913044-59913066 CATATGTGTTGGAGGGTAAAGGG + Intergenic
1138856647 16:60701679-60701701 CAGAAGTGGTGGAGGGTTAATGG - Intergenic
1140754084 16:78051938-78051960 TACCTGGAGTGGAGGATAAACGG - Intronic
1141763562 16:86044488-86044510 CAGCAGTGGTGGGTGAGAAAGGG - Intergenic
1142144540 16:88487433-88487455 GAGCTGGGGTGGAGGAGAGATGG + Intronic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1143233596 17:5378900-5378922 CAGGTGTGGTGGGAGATGAAGGG - Intronic
1143455994 17:7068148-7068170 CAGCTCTGGATGTGGATAAAAGG - Intergenic
1144784010 17:17821907-17821929 CAGCTGTGGGTGAGGATTAGGGG - Intronic
1145747796 17:27332950-27332972 CATCTTCGGTGGAGGAGAAAGGG + Intergenic
1145783869 17:27581626-27581648 CAGCTGTGGGGGTGGAGAGAGGG - Intronic
1146352525 17:32106848-32106870 CAGCTGTGCTGGTGGCTAATGGG + Intergenic
1147554421 17:41467336-41467358 TAGCTGTGGCTGAGGAGAAAGGG - Exonic
1149259129 17:54859813-54859835 CAGAGGTGGAGGAGGTTAAAGGG + Intergenic
1149961863 17:61118439-61118461 CAGTTTTGGTGCAGGACAAATGG - Intronic
1150233494 17:63573365-63573387 CAGCCTTTGTGGAGGAGAAACGG - Intronic
1150445228 17:65223454-65223476 CAGCTCTGGTGGGGGAAGAAAGG - Intronic
1150521666 17:65873587-65873609 TAGGTGTGCTGGGGGATAAATGG - Intronic
1150757524 17:67928951-67928973 CAGCTGTGCTGGTGGCTAATGGG - Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1152035941 17:77872884-77872906 CAGGTGTGGAGGAGCATATATGG - Intergenic
1153589887 18:6662325-6662347 AAGCTGTCGTGAAGGAGAAATGG + Intergenic
1154026865 18:10716191-10716213 CAGCAGAGGTGGAGGAGAGAAGG - Intronic
1154327534 18:13402257-13402279 CAGCTGTGGTTGTGAAGAAAGGG - Intronic
1155272515 18:24154319-24154341 CAGATGTGCTGGTGGATAAAAGG + Intronic
1156217200 18:35011687-35011709 CAGCTGGGGTAGAGGTTAATGGG + Intronic
1158514920 18:58123103-58123125 CAGAGGTGGTGGAGGATGTAAGG - Intronic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1159355927 18:67337417-67337439 CAGAAGTGGTGGAGGGTAGAAGG + Intergenic
1159476086 18:68922572-68922594 GAGCTGTGGTTGATGATAAAAGG + Intronic
1160259866 18:77282465-77282487 CAACTATGGTGGAGGGTGAACGG - Intergenic
1161232465 19:3181186-3181208 CTGCTGTGTTGGTGGGTAAATGG - Intergenic
1162883744 19:13680689-13680711 AAGCTGTGTGGCAGGATAAAAGG + Intergenic
1163191421 19:15679562-15679584 CAGCTGTGGTCGAGGACACTTGG + Intronic
1164412967 19:28020987-28021009 CAGCTCTGGTGGAGGGAAGAGGG - Intergenic
1166783529 19:45354404-45354426 CATCTGTGCTGGAGGATAACAGG + Intronic
926423608 2:12721278-12721300 CAGCAGTGGAGCAGGATAATAGG + Intronic
927034512 2:19159665-19159687 CAGCTGTGGTGCAGCATATAGGG + Intergenic
927868187 2:26606420-26606442 GAGATGTGGTGGAGGATTCAGGG + Intronic
928091453 2:28377386-28377408 CAGCGGTGGTGGTGGAGATAGGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930590661 2:53322838-53322860 AAGCTGTGGGGCAGGATAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932734777 2:74246964-74246986 GAGCTGTGGTGAAGGATCAGGGG + Intronic
933725314 2:85423688-85423710 CAGCTGTGATGGGTGATGAAGGG - Intronic
934537817 2:95150813-95150835 GAGCTATAGTGGAAGATAAAGGG - Intronic
935000353 2:99008492-99008514 CCACTGTGGTGGATGAGAAATGG - Intronic
936456877 2:112682001-112682023 AAGGTGTGGTGGAGGCCAAAAGG - Intergenic
936804800 2:116317942-116317964 CTGCTGTGGTAGCAGATAAATGG + Intergenic
937616931 2:123935589-123935611 CAGCTGTGGTGGTGGCAGAAGGG + Intergenic
937924108 2:127154454-127154476 GAGCTGTGGAGGAGGATGTAAGG - Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
943736562 2:191362901-191362923 CAGCTGTGGTGATGGGGAAAGGG + Intronic
943822257 2:192340373-192340395 CAGATATGGCAGAGGATAAAGGG + Intergenic
944943499 2:204655711-204655733 AATCTGTTGTGGAGGATTAAAGG + Intronic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
946049257 2:216848313-216848335 CAGTTGTGGTGGTGGATGATAGG + Intergenic
946832780 2:223742908-223742930 TAGCTGGGGTGGGGGATAGAGGG - Intergenic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
947998426 2:234547777-234547799 GAGGAGTGTTGGAGGATAAATGG + Intergenic
948263351 2:236620693-236620715 CAGCTGGGGCGGAGGGTGAAGGG + Intergenic
948658720 2:239493297-239493319 CAGTTGTGGTGGAAGGCAAACGG + Intergenic
1169084671 20:2819324-2819346 CAGCTGGGCAGGAGGGTAAAAGG - Intronic
1169464166 20:5823012-5823034 TAGCAGTGGTGGAGTATATATGG - Intronic
1170544080 20:17418508-17418530 CAAGTGAGGTGGAGCATAAAAGG + Intronic
1170909383 20:20549515-20549537 CAGCACTGGGGGAGGGTAAATGG + Intronic
1171283873 20:23922267-23922289 CAGCTGTGCATTAGGATAAATGG + Intergenic
1173169996 20:40716211-40716233 CAGCTGAGGTGAAGGATGATGGG + Intergenic
1173401322 20:42728624-42728646 CAGCTGTCGTGTAGGAACAATGG - Intronic
1173416059 20:42856916-42856938 CAGCTGGGGTGCAGTAAAAAGGG + Intronic
1173733417 20:45343666-45343688 CAGCTGTGGGGGTAGATAAGGGG + Intronic
1174669035 20:52288708-52288730 CAGGTGTGGTGGAAGATGATGGG + Intergenic
1175297559 20:57919506-57919528 CGCCTGTGGTGGAAGATAAGGGG - Intergenic
1175612612 20:60364244-60364266 AGGCTGTGGTGGAGGATAGGAGG - Intergenic
1175935713 20:62513019-62513041 CAGCTGAGGAGGAGGACAACGGG - Intergenic
1176375073 21:6083017-6083039 CAGCTATGGGGGAGGGTAACTGG - Intergenic
1178503396 21:33144130-33144152 CAGCTATGGGGGAGGGGAAAGGG + Intergenic
1179489401 21:41730410-41730432 CAGCTTTCATGGAGGAGAAAAGG - Intergenic
1179748401 21:43455227-43455249 CAGCTATGGGGGAGGGTAACTGG + Intergenic
1181620378 22:24087072-24087094 CAGCTCTGGTGGAGAGGAAAAGG - Intronic
1181638296 22:24184371-24184393 CAGCTGTGTGGGAGGAGGAAGGG + Intronic
1181769748 22:25116752-25116774 CAACTCTGGTGCAGGAGAAATGG + Intronic
1183087256 22:35493989-35494011 CAGCTGGGGAGGAGGAGAAGTGG - Intergenic
949776052 3:7633610-7633632 CAGGAGTAGTGGAGGATAGAAGG - Intronic
949933797 3:9101203-9101225 CTGCTGTAGAGGATGATAAAAGG + Intronic
950599157 3:14016830-14016852 CTGCTGTGGTGGAGGTTTCAGGG + Intronic
951541945 3:23790146-23790168 CAACAGTGGAGGAGGATGAATGG + Intergenic
952106416 3:30075073-30075095 CAACTGTGGTGGTGGTTACAAGG + Intergenic
952268259 3:31807417-31807439 ATGCTGTGTTGGAGGATATATGG + Intronic
955904576 3:63793405-63793427 GAGAAGAGGTGGAGGATAAAAGG - Intergenic
958072565 3:88633387-88633409 CAACTATGGTGGAAGACAAAGGG + Intergenic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960965651 3:123102819-123102841 CAGCAATGGTGGAGTCTAAATGG + Intronic
961510199 3:127396150-127396172 CTGCTCTTGTGGAGGATGAAGGG + Intergenic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
967783343 3:193463583-193463605 GAGCTGTGGTGAAGATTAAATGG + Intronic
969348069 4:6581613-6581635 AAGGTGAGATGGAGGATAAAGGG - Intronic
969443939 4:7233541-7233563 CAGCTGTGGTGGTGGGTGGACGG + Intronic
970071003 4:12160110-12160132 CAATTATGGTGGAAGATAAAGGG - Intergenic
970168986 4:13269978-13270000 CAACAGTGGGGGAGGAGAAAAGG - Intergenic
970548144 4:17150508-17150530 CACTTGTGGTCGAGAATAAAAGG + Intergenic
970653283 4:18201519-18201541 CAGTTGTGGTGGAAGGTGAAAGG + Intergenic
971597772 4:28553917-28553939 CAACTGTGGTGGAAGGCAAAGGG + Intergenic
973982899 4:56321165-56321187 AGGCAGTTGTGGAGGATAAACGG + Intronic
975646833 4:76554122-76554144 CAGCAGTGGCTGAGGTTAAAGGG - Intronic
978152410 4:105452664-105452686 CAGTTGGGGTAGAGAATAAATGG + Intronic
979114316 4:116801931-116801953 CAGCTTTGGTGGTAGAGAAATGG + Intergenic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
980557797 4:134431433-134431455 CAGCTGTGGAAGAGGATGATGGG - Intergenic
981184265 4:141782641-141782663 CAGCTCTGGTTGTGGTTAAAAGG - Intergenic
981723704 4:147826327-147826349 CAGCTGTGATGGAGGTTGATAGG + Intronic
981971952 4:150674352-150674374 CAACTGTGGTGAACAATAAAAGG - Intronic
981999933 4:151013245-151013267 CACCTGTGTTAGAGGATAACAGG - Intronic
982030271 4:151293625-151293647 ATGCTGTGGAGGAGAATAAATGG - Intronic
982411607 4:155084122-155084144 CTGCTCTGGTGGTGGATAGATGG + Intergenic
984126729 4:175819544-175819566 CTGTTGTGGTGAAGGTTAAATGG - Intronic
985563812 5:605201-605223 CAGTTGTGGTGGAAGGTAAAGGG + Intergenic
985800684 5:2003862-2003884 CAGCTGAGGCGGAGGAAAGAGGG + Intergenic
986238735 5:5937710-5937732 CTGCTGAGGTGGAGAATAGAGGG + Intergenic
986577213 5:9224885-9224907 CAACTGTGGGGGAGGATGAGAGG + Exonic
986884565 5:12217180-12217202 AAGCTGTGAGGGAGGAAAAAAGG + Intergenic
987018347 5:13844108-13844130 GTGCTGTGGTGGAGGAGACAGGG - Intronic
987398413 5:17448343-17448365 CTTCTGTCGGGGAGGATAAAAGG - Intergenic
987852329 5:23372514-23372536 CCACTGTGGTGGTTGATAAATGG + Intergenic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
988889562 5:35599843-35599865 CTGCTCTGGTGGAGGTTAGAGGG - Intergenic
989543783 5:42648466-42648488 CACATGTATTGGAGGATAAAAGG + Intronic
991339186 5:65587233-65587255 AGGCTGTGTTGGAGGACAAATGG - Exonic
992033261 5:72745726-72745748 CAGTTGTGGTGGAAGGTGAAGGG + Intergenic
993391006 5:87319562-87319584 CAGCTGTGGCTGTGGCTAAAAGG - Intronic
994573713 5:101548218-101548240 CAGCAGTGGAGGATTATAAATGG + Intergenic
997336624 5:133113278-133113300 CAGGAGAGGTGGAGGAGAAAGGG + Intergenic
997405643 5:133644582-133644604 CAGCTTTGGTGGAGAAGACATGG + Intergenic
999270110 5:150291846-150291868 GGGCTGTGGGGGAGAATAAAGGG + Intergenic
1000989366 5:167896215-167896237 CAGCTGGGGTGGAGGATTTTAGG + Intronic
1001210812 5:169808536-169808558 CAGCTCAGGTGAAGGATAAAAGG + Intronic
1001609714 5:172990407-172990429 TAGATGTGGGGGAGGAGAAAAGG + Intronic
1001987839 5:176090794-176090816 CAGCTGTGGTGAGGAATGAATGG - Intronic
1001987974 5:176091946-176091968 CAGCTGTGGTGGACGATGAATGG - Intronic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001990154 5:176109861-176109883 CAGCTGTGGTGGACGATGAATGG - Intronic
1001998121 5:176178384-176178406 CAGCTGCCATGGAGGATGAAAGG + Intergenic
1001998320 5:176179903-176179925 CAGCTGTAGTGGAGGATGAATGG + Intergenic
1002226717 5:177728278-177728300 CAGCTGTGGTGGACGATGAATGG + Intronic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1002228896 5:177746194-177746216 CAGCTGTGGTGGACGATGAATGG + Intronic
1002229032 5:177747347-177747369 CAGCTGTGGTGAGGAATGAATGG + Intronic
1002266315 5:178036436-178036458 CAGCTGTGGTGAGGAATGAATGG - Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002649904 5:180683761-180683783 CAGCTGAGGTGGAGGATGAATGG - Intergenic
1004061430 6:12201921-12201943 TTGCTGAGTTGGAGGATAAAAGG + Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1008236310 6:49055839-49055861 TGGCTGTGGTGGTGGATACATGG - Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012413052 6:98981652-98981674 CAGCTGAGGGAGAGGCTAAATGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013548363 6:111182600-111182622 CAGCTCTGGTGGAGGATTCAGGG - Intronic
1013666188 6:112351353-112351375 TAGCTGTGGTGGAGGAAGAGGGG - Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1018867899 6:167759692-167759714 CAGCTGTGGAGGAGGAGATCAGG + Intergenic
1019491306 7:1314790-1314812 CAGCTGTGGTGGAGTCTCAGGGG + Intergenic
1020460143 7:8421051-8421073 CAGCTGTCGTGTAGATTAAACGG + Intergenic
1023311772 7:38894843-38894865 CAGCTGATGAGGAGGAGAAAGGG - Intronic
1024834929 7:53505597-53505619 CTCCTGTGTTGGAGAATAAAAGG + Intergenic
1027893019 7:84001371-84001393 CATCTGTGATTCAGGATAAAGGG + Intronic
1028802361 7:94981046-94981068 CAGCTGTGCTAGAGAATAATGGG + Intronic
1029610591 7:101624594-101624616 CAGCTGTAGTGGAGGATGCCGGG - Intronic
1032163384 7:129527229-129527251 AAGCTGAGCTGGAGGATGAACGG - Intergenic
1032391513 7:131557903-131557925 CAGCTTTGGGGGTGGAAAAAAGG - Intronic
1032735847 7:134692098-134692120 GTGCGGTGGTGGAGGATGAAGGG + Intergenic
1032975970 7:137222778-137222800 TGGATTTGGTGGAGGATAAAAGG - Intergenic
1033526441 7:142219015-142219037 CACCTGTGGTATAGGATAAAAGG + Intronic
1034077394 7:148245424-148245446 CTGATGTGGAGGAGGATGAAGGG + Intronic
1035495153 7:159318600-159318622 CAGCTGTGGAGGAGAGTCAAGGG + Intergenic
1035639787 8:1176148-1176170 CAATTGTGGTGGAAGATGAAGGG + Intergenic
1036569558 8:9968101-9968123 CAGCTGTGGTTGAGGGGATAAGG + Intergenic
1038436575 8:27540739-27540761 GGGCTGTGGTGGAGGAGAACTGG - Intronic
1041250128 8:55925587-55925609 TGGCTGTGGTGGAGTTTAAATGG - Intronic
1041656929 8:60361591-60361613 CCTCTGTGGTGGAGAATAAAGGG - Intergenic
1041707303 8:60860042-60860064 GAGCTGTGGGGAAGGAGAAATGG + Intronic
1041759889 8:61354315-61354337 CAACTGTTGTTGAGGATATAAGG + Intronic
1042163754 8:65924562-65924584 CAGCTGTGATGGAGGCACAAGGG - Intergenic
1043436575 8:80240976-80240998 CAGCCGTGGTAGAAGAAAAAAGG - Intergenic
1043737090 8:83762008-83762030 AAGCTATGGTGGGGGAAAAAGGG + Intergenic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1044354939 8:91210083-91210105 CGACTTTGGTGGAGGCTAAAAGG + Intronic
1044618364 8:94165314-94165336 CAGCTGTCGGGGAGTCTAAAGGG - Intronic
1044690964 8:94878074-94878096 CAGGTGAGGTAAAGGATAAAGGG - Intronic
1047229593 8:122985146-122985168 AGGCTTTGGTTGAGGATAAAGGG - Intergenic
1049099040 8:140566298-140566320 CAGTCATGGTGGAGGACAAAAGG - Intronic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049915804 9:317251-317273 CAGCTGTGGAGTAGTAGAAAGGG + Intronic
1051351106 9:16198649-16198671 CAGCTGTGGAAGAGCAGAAAAGG - Intergenic
1052598076 9:30587284-30587306 CAGATGTTGAGGAGGATGAATGG - Intergenic
1052912671 9:33897706-33897728 GAGGTGGGGTGGAAGATAAAAGG - Intronic
1053353927 9:37430940-37430962 CCTTTGTGGTGGAGGATAATGGG - Intronic
1053409432 9:37906041-37906063 CAGCTGGGTTGGAGGATATCTGG - Intronic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1058397024 9:104565824-104565846 CAGCAATGGAGGAGAATAAAGGG - Intergenic
1186891547 X:13963930-13963952 CAGCTGGGTTGGTGGATAATTGG - Intergenic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1188450266 X:30301407-30301429 CAGCTGGGATGGAAGAGAAAGGG - Intergenic
1190033876 X:47001556-47001578 CAGCTGTGGTTGAGGAAATTAGG - Intronic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1192409880 X:70924635-70924657 CAGCTGTGGTAAAAGATAAAAGG - Intergenic
1192427788 X:71092704-71092726 TAGCTGGGGTGAAGGAAAAAGGG + Intergenic
1194223252 X:91222992-91223014 GAGTTGTGGAGGAGGCTAAAAGG + Intergenic
1194479306 X:94400886-94400908 CAGTGGTGGTGGTGGATACAGGG - Intergenic
1195156400 X:102127351-102127373 TGGCTAGGGTGGAGGATAAAAGG + Exonic
1195329100 X:103782342-103782364 GAGCTGTAGTGGAGCAGAAAAGG + Intronic
1195791405 X:108591708-108591730 AAGGTGTGATGGAGGATACAGGG - Intronic
1200362111 X:155618181-155618203 CAGGTGTTGAGGAGGAGAAAGGG - Intronic