ID: 1002236597

View in Genome Browser
Species Human (GRCh38)
Location 5:177807859-177807881
Sequence GGCGGTGGTGACAGAGACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002236592_1002236597 9 Left 1002236592 5:177807827-177807849 CCTGCAACACTGTGGCTCGCCTC No data
Right 1002236597 5:177807859-177807881 GGCGGTGGTGACAGAGACAGCGG No data
1002236596_1002236597 -10 Left 1002236596 5:177807846-177807868 CCTCGCTACAGTTGGCGGTGGTG No data
Right 1002236597 5:177807859-177807881 GGCGGTGGTGACAGAGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002236597 Original CRISPR GGCGGTGGTGACAGAGACAG CGG Intergenic